Molecular cloning and gene expression of desaturases and elongases in embryos, larvae, and adults of bay snook Petenia splendida (Cichliformes: Cichlidae)

Luis Daniel Jiménez-Martínez1 , Gloria Gertrudys Asencio-Alcudia2, Carlos Alfonso Álvarez-González2, Alejandra del C. Castillo-Collado1, Vicente Morales-Garcia3, Carina Shianya Alvarez-Villagomez2, Candelario Rodríguez-Pérez1, Rafael Martínez-García2, César Sepúlveda-Quiroz2,4 and Graciela María Pérez-Jiménez2

PDF: EN    XML: EN | Cite this article

Abstract​


EN

The bay snook (Petenia splendida) belongs to the family Cichlidae, distributed in the southeastern region of Mexico and Central America, and it is a very important cichlid at a commercial level. Despite their potential for aquaculture, little information exists on their metabolic pathways related to physiology and nutrition. This study focuses on the expression of the fatty acid desaturases (fads2) and elongases (elovl4b and elovl5) genes in embryos 0 days post-hatching (dph) and larvae of 5, 10, 15, 20, 25, and 30 dph. Additionally, the differential expression of these genes was analyzed in the liver, intestine, kidney, muscle, heart, testes, gills, stomach, pancreas, brain, and adipose tissue in adult fish. Our study utilized specific qPCR primers designed for fads2, elovl4b, and elovl5 to detect the expression of these genes. We found the highest expression were observed in larvae at 20 dph and adults, predominantly in the liver and intestine of the three genes tested. Importantly, our results showed that the desaturase and elongase genes are differentially expressed in the tissues of adults of P. splendida, and their expression fluctuates during larval development.

Keywords: Desaturase, Early ontogeny, Elongases, Gene expression, Petenia splendida.

E

La mojarra tenguayaca (Petenia splendida) pertenece a la familia Cichlidae, se distribuye en la región sureste de México y Centroamérica y es un cíclido de gran importancia a nivel comercial. A pesar de su potencial para la acuicultura, existe poca información sobre sus vías metabólicas relacionadas con la fisiología y la nutrición. Este estudio se centra en la expresión de los genes de las desaturasas de ácidos grasos (fads2) y elongasas (elovl4b y elovl5) en embriones de 0 días post-eclosión (dpe) y larvas de 5, 10, 15, 20, 25 y 30 dpe. Adicionalmente, se analizó la expresión diferencial de estos genes en hígado, intestino, riñón, músculo, corazón, testículos, branquias, estómago, páncreas, cerebro y tejido adiposo en peces adultos. En nuestro estudio, utilizamos oligonucleóticos específicos diseñados para fads2, elovl4b y elovl5 para determinar la expresión relativa a través de qPCR. Descubrimos que la expresión más alta se observó en larvas a los 20 dph y en adultos, predominantemente en el hígado y el intestino de los tres genes analizados. Es importante destacar que nuestros resultados mostraron que los genes de la desaturasa y la elongasa se expresan de manera diferencial en los tejidos de los adultos de P. splendida y su expresión fluctúa durante el desarrollo larvario.

Palabras clave: Desaturase, Elongasas, Expresión de genes, Ontogenia temprana, Petenia splendida.

Introduction​


The bay snook (Petenia splendida Günther, 1862) belongs to the Cichlidae family, distributed in the southeastern region of Mexico and Central America (Álvarez-González et al., 2008). This species has piscivorous habits, although it also feeds on plant remains and insects, inhabiting freshwater bodies, and some studies indicate that it has a tremendous reproductive capacity and high fecundity (Alvarez-González et al., 2013). Additionally, P. splendida is accepted in local markets and has high economic value and great potential for aquaculture. Our research, therefore,can significantly contribute to this field, potentially aiding aquaculture and conservation efforts (Alvarez-González et al., 2010). In this sense, there are several studies describing different aspects of P. splendida, such as its biology and physiology (Jiménez-Martínez et al., 2009; Treviño et al., 2011), taxonomy and ecology (Méndez-García, 2010), aquaculture technology (Pérez-Sánchez, Páramo-Delgadillo, 2008; Vidal-López et al., 2009), cytogenetics (Arias-Rodríguez et al., 2008), molecular biology (Castillo-Collado et al., 2022), and nutrition and digestive physiology (Álvarez-González et al., 2008; Uscanga-Martínez et al., 2011; Rodríguez-Estrada et al., 2020).

Studies on the nutritional and energetic needs of aquatic organisms are crucial to maximizing growth in less time and improving the profitability of the culture. Optimizing the use of nutrients, particularly dietary lipids, is fundamental to the metabolic functions of these organisms (Lee et al., 2003). In this context, lipids are divided into saturated (no double bond) and unsaturated fatty acids that have one or more double bonds (unsaturation) along the carboxylic chain, and they can be divided into monosaturated (MSFA) and polyunsaturated fatty acids (PUFA) (Fahy et al., 2011). Long-chain polyunsaturated fatty acids (LC-PUFA) are essential and contain more than 20 carbons in their molecular structure with multiple double bonds. They can be classified as n-3 and n-6 according to their final double-bond position with the final methyl group (Monroig et al., 2011a), particularly LC-PUFA, play a crucial role in the fluidity of the membrane structure and signaling processes, which are relevant in many physiological functions such as growth, neurological functions, inflammation, immune response, and reproduction (Colombo et al., 2017; Ayisi et al., 2018). LC-PUFA requirements, such as arachidonic acid (ARA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA), are essential for fish, mainly marine fish (Takeuchi, 1997; Mejri et al., 2021), due to the lack of desaturases and elongases genes, many marine species are not able to synthesize these kinds of PUFA (Monroig et al., 2022). Considering the above, molecular studies of the enzymes involved in lipid synthesis have recently been developed, revealing a diversity of biosynthesis routes in different nonaquatic organisms. In contrast, studies in fish have shown a great diversity of adaptations in lipid metabolic pathways (Morais et al., 2015).

DuringLC-PUFA biosynthesis from C18 PUFA, two families of enzymes of great importance participate in fatty acyl desaturases (fads) and very long chain fatty acid elongation (elovl). The first enzyme is responsible for introducing a new double bond (unsaturation) between the carboxyl terminus of a fatty acyl chain and a pre-existing double bond. At the same time, elovl is responsible for catalyzing the initial rate-limiting condensation reaction of chain elongation fatty acyl. According to various works, fasd1 has been lost in modern teleost, with a predominance of fads2 presenting a great ∆4, ∆6, and ∆5 diversification, mainly in freshwater fish (Fonseca-Madrigal et al., 2014; Ferraz et al., 2019; Li et al., 2019; Lopes-Marques et al., 2018; Garrido et al., 2019, 2021). In the case of Elovl, three isoforms are recorded in teleost elovl2, elovl4b,and elovl5, which areinvolved in the processes of LC-PUFAbiosynthesis (Castro et al., 2016; Zhu et al., 2018).

Despite the extensive research on lipid metabolism, the function of the genes that code for the desaturase and elongase enzymes and their conversions remains a mystery, particularly in this species of cichlid, such as P. splendida. For this reason, this study presents a groundbreaking approach by aiming to clone the partial sequences, functional characterization, and tissue distribution of fads2, elovl4, and elovl5 involved in the metabolic pathways of LC-PUFAbiosynthesis in adults and on the initial ontogeny of P. splendida.

Material and methods


Fish acquisition. A total of 20 adult P. splendida specimens were obtained from the Laboratory of Physiology in Aquatic Resources (LAFIRA) in the División Académica de Ciencias Biológicas at the Universidad Juárez Autónoma de Tabasco, Southeast Mexico (catalog number ECOSC 14897 of Petenia splendida included in the ichthyological collection of the Colegio de la Frontera Sur (ECOSUR) in San Cristóbal de las Casas, Chiapas, Mexico). Fish were kept in circular 2000-L polyethylene tanks and were fed with a rainbow trout diet (45% protein and 16% fat, El Pedregal® Silver Cup, Toluca, Mexico) at apparent satiation three times per day (7:00, 13:00 and 19:00 h) with particle diameters ranging between 5.5 and 9.0 mm. Water parameters were constantly assessed with a YSI 85® Meter, YSI Inc., Yellow Springs, OH (temperature (28.0 ± 0.7°C), dissolved oxygen (5.9 ± 0.6 mg/L), and pH (7.1 ± 0.3)). Embryos and larvae were obtained from spontaneous spawning from the broodstock in the same facility. Six females and three males were transferred from holding tanks to a 2000-L breeding tank. Six acrylic sheets (one side smooth, one side rough) were placed in each tank to provide shelter and egg-laying surfaces (rough side). Right after hatching, larvae were separated from the adults. After 3 days, 150 larvae per tank were placed in three 70-L oval tanks with constant aeration (~95% air saturation) connected to an open system with water changes (80%) every two or three days. Larvae were fed satiety with brine shrimp (Artemia sp.) nauplii five times per day (8:00, 11:00, 13:00, 15:00, and 18:00 h) for 7 days (until 10 days post-hatching, dph). From 11 to 13 dph, larvae were provided with a co-feeding of brine shrimp nauplii and trout feed (Silver Cup, Nelson and Sons, Inc; proximate composition: 45% proteins, 16% lipids, 21% carbohydrates, 9–12% ashes) and from the 14 dph, larvae were only provided with trout feed until 30 dph. Food was provided at apparent satiation, and particle size was adjusted according to larval growth (250–500, 500–750, and > 750 μm). During larviculture, water parameters were constantly assessed with a YSI 85® Meter, YSI Inc., Yellow Springs, OH (temperature (28.1 ± 0.5 °C), dissolved oxygen (5.8 ± 0.5 mg/L), and pH (7.0 ± 0.2).

Sampling. Captive P. splendida male adults were euthanized by cold thermal shock (-4 °C) after 24 h of fasting and dissected for the harvesting collection of 11 organs: liver, intestine, kidney, muscle, heart, testis, gill, stomach, pancreas, brain, adipose tissue. Larvae were sampled on different days after hatching (10 larvae per tank) before first feeding, starting from the embryo (considered as 0 dph) and 5, 10, 15, 20, 25, and 30 dph. Larvae were removed from each tank, rinsed in distilled water, and transferred to Eppendorf tubes with 1.5 mL of RNA Later and stored at -80°C.

RNA extraction and cDNA synthesis. RNA extraction was performed from tissues and pooled larvae (10 individuals) using the Trizol Reagent (Invitrogen, Carlsbad, CA) method under the manufacturer’s indications. RNA concentration and purity (through the 260/280 ratios) were measured with a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The integrity of RNA was confirmed after observing two discrete bands for 28s and 18s ribosomal RNA in a native agarose electrophoresis (1.5%). The First strand cDNA synthesis process using the iScript TM Select cDNA Synthesis Kit 170–8,896 (Bio-Rad, Hercules, CA). Reverse transcription reactions were performed following the kit manufacturer’s protocol. First-strand cDNA was synthesized by incubating a 20 µL total reaction mix containing 2 µL random primer, 4 µL 5x iScript select reaction mix, 1 µL reverse transcriptase, 1 µg total RNA, and nuclease-free water at 25°C for 5 min and then at 42°C for 30 min. Inactivation of reverse transcriptase was performed by incubating the reaction mix at 85°C for 5 min and the product was stored at -20°C for use in PCR amplification. Subsequently, 1 µL of cDNA was used for the end-point Polymerase Chain Reaction (PCR). The cDNA samples were run in a 96-well thermocycler using the Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA) to obtain the partial sequences of fatty acyl desaturase(fads2)and fatty acyl elongases(elovl4b and elovl5). Amplification was conducted under the following conditions: 10 min at 95°C, followed by 35 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 50 s with a 5 min extension at 72°C using specific oligonucleotides previously determined from alignment (using Clustal‐W software, Infobiogen) of corresponding sequences available in the library from different species for the fads2 gene, the sequences of fish such as Nile tilapia (Oreochromis niloticus KF268464.1), princess cichlid (Neolamprologus pulcher,XM 006789228.2), flameback (Pundamilia nyererei, XM 005730101.1) and Eastern happy (Astatotilapia calliptera, XM 026175749.1) while for the gene elovl4 sequences of the fish were taken from Neolamprologus pulcher (XM 006797273.1), Astatotilapia calliptera (XM 026143115.1), Oreochromis niloticus (XM 003440621.5) and Stegastes partitus (008302422.1). Finally, for the gene elovl5, the sequences were obtained from Oreochromis niloticus (NM 001279460.1), Neolamprologus pulcher (XM 006800731.2), Maylandia zebra (XM 023153084.2), and Astatotilapia burtoni (XM 005915537.3) (Tab. 1).

TABLE 1 | Oligonucleotides used for sequencing and real‐time polymerase Chain Reaction in Petenia splendida.

Primer name

Forward primer (5’−3’)

Reverse primer (5’−3’)

Size, pb

Step

fads2

ctggtttgtgtgggtkactb

cgagcaccacttgtttccaa

tytatrgagatatgcatcca

cccagaggttttcagtgacg

317

154

RT-PCR

qPCR

elovl4b

elovl5

actb

ctggacacggtctdctwcat

cagcgttcggaccaaagatc

tactgccaga achctcacng

cacctctaccaccacgctag

gagctatgagctgcctgatgg

bggtmggtctggtagtaaaa

aggatgatgtacgtgacggc

aggtvtgsccggatggctgg

gatggctggaatggctgaga

gtggtctcatgaatgccacagg

377

178

285

150

119

RT-PCR

qPCR

RT-PCR

qPCR

qPCR


The amplification products were separated in 1.5% agarose gel stained with ethidium bromide. Observed bands under UV light (Bio-Rad® Model Universal Hood II, Hercules, CA) were cut from the gel and purified using the PureLink® PCR Purification Kit (Invitrogen). The purified bands were sent to the Synthesis and Sequencing Unit of the Institute of Biotechnology of the Universidad Nacional Autónoma de México (UNAM) to be sequenced.

Sequence analysis. Obtained partial sequences were edited and analyzed using ExPASy translation software to search for the open reading frame (ORF). Once the ORF was identified, it was translated to amino acid (AA) sequences using standard genetic codes. The nucleotide sequence was compared with DNA sequences from other fish available in the GenBank database network service at NCBI (https://blast.ncb i.nlm.nih.gov/). Protein sequence alignments were performed by the multiple sequence alignment software BioEdit 7.2 (www.mbio.ncsu.edu/bioedit/bioedit.html). A phylogenetic tree was generated using neighbor-joining (NJ) methods based on the AA sequence using MEGA 7.0 software.

Quantitative polymerase chain reaction (qPCR). The resulting cDNA from adult tissues, embryos, and larvae were diluted in 200 μL of distilled water. The quantitative polymerase chain reactions (qPCRs) were performed in a 96-well thermocycler CFX96 Real‐Time System Thermal Cycle (Model C1000, CA). The reaction mixture included 10 μL of Eva Green, 2 μL cDNA, and 0.2 μL of each primer (shown in Tab. 1). The thermal program included 2 min at 95°C, followed by 38 cycles at 95°C for 10 s, 60°C for 30 s, and extension at 70°C for 5 s. Duplicates performed all reactions. To normalize the gene expression of the evaluated genes, it is important to mention that three reference genes were used: actb, ef1, and 18S rRNA; however, actb was considered the best for the larvae/tissue samples since it complied with a constitutive and stable expression according to Jiménez-Martínez et al., 2022. A standard curve for each pair of primers was generated to estimate amplification efficiencies based on known amounts of cDNA (four serial dilutions corresponding to cDNA transcribed from 100 to 0.1 ng of total RNA), obtaining values ​​between 97 and 99%. The melting curve analysis determined that the melting temperature peak varied between 81.5 and 83 °C, which corresponded to the product obtained by these primers. In addition, the absence of primer dimers and nonspecific ties was confirmed. Relative gene expression of tissues and larval growth stages was calculated using the delta-delta copy threshold (CT) method (Pfaffl, 2001).

Statistical analysis. The relative expression of the gene fatty acyl desaturase fads2 and fatty acyl elongases elovl4b and elovl5 between the different tissues of P. splendida adult and the comparison between embryos and larvae at different ages (dph) were analyzed using the Kruskal-Wallis test. A posteriori Nemenyi test was performed to determine significant differences between tissues (adults) and developmental time (embryos and larvae) (P ≤ 0.05). All statistical analyses were performed using the software Statistica TM v. 7.0 (Statsoft, Tulsa, OK).

Results​


TABLE 1 |

PCR amplification and sequencing analysis. A meticulously obtained partial sequence for fads2of 317 bp that encodes 105 AA was registered in the GenBank accession number ON 142679 (Fig. 1A). Similarly, the gene elovl4b was sequenced with utmost precision, obtaining a partial sequence of 377 bp that encodes 120 AA with accession number ON720978 (Fig. 1B). Finally, for the elovl5 gene, a carefully obtained partial sequence of 285 pb that encodes 95 AA with accession number ON142677 (Fig. 1C).

FIGURE 1| Partial sequence of nucleotides and amino acids (AA) encoding delta-6-desaturase (fads2) (A), fatty acid elongase 4 (elovl4b) (B), fatty acid elongase 5 (elovl5) (C), and from Petenia splendida taken from Gen Bank to design specific oligonucleotides for qPCR.

The phylogenetic tree revealed intriguing evolutionary relationships. We observed that P. splendida fads1 forms a clade with a high bootstrap of 99% with Nile tilapia, indicating a close evolutionary relationship, and a bootstrap of 48% with Hippoglosus stenolepis (Fig. 2A). Similarly, elovl4b forms a clade with a strong bootstrap of 100% between P. splendida and Nile tilapia, suggesting a recent common ancestor, and a bootstrap of 31% with Astatotilapia burtoni (Fig. 2B). Finally, elovl5 forms a clade with a robust bootstrap of 100% between P. splendida and Nile tilapia, and a bootstrap of 58% with Neolamprogus pulcher (Fig. 2C).

FIGURE 2| Phylogenetic tree based on the sequence of delta-6-desaturase (fads2) (A), fatty acid elongase 4 (elovl4b) (B), fatty acid elongase 5 (elovl5) (C) from Petenia splendida and other teleosts using the neighbor-joining (NJ) method. Values at branch points represent percentage frequencies for tree topology after 1,000 interactions.

Relative expression in adult fish tissues. The relative expression in the tissues of P. splendida adults showed that the fads2 gene had the highest expression in the liver, indicating its crucial role in this organ’s function. It is followed by the intestine, suggesting its involvement in digestion. Lower levels of expression were detected in adipose tissue, brain, pancreas, stomach, gill, muscle kidney, testis, and heart, indicating its presence in these tissues as well (P ≤ 0.05) (Fig. 3A). The highest expression level of elovl4b was detected in the testis, suggesting its role in reproductive functions, followed by the intestine with low expression detected in the other tissues analyzed (P ≤ 0.05) (Fig. 3B). Concerning elovl5, the highest expression was detected in liver, followed by the intestine and lower levels of expression were detected in the brain, kidney, pancreas, muscle, heart, testis, gills and stomach in P. splendida adults, indicating its widespread presence in various organs (P ≤ 0.05) (Fig. 3C).

FIGURE 3| Relative expression of delta-6-desaturase (fads2) (A), fatty acid elongase 4 (elovl4b) (B), fatty acid elongase 5 (elovl5) (C) in the liver (L), intestine (I), kidney (K), muscle (M), heart (H), testis (T), gill (G), stomach (S), pancreas (P), brain (B), adipose tissue (AT) of adult Petenia splendida (mean ± SEM; n = 3). Lowercase letters indicate significant differences between the tissue expression levels (p < 0.05).

Relative expression in larvae. The fads2, elovl4b,and elovl5 transcripts were detected from the embryo, decreased at day 5, 10, and 15 dph, and the highest expression was detected on days 20, followed by 25 and 30 dph (Figs. 4A–C). This gene expression pattern suggests that these genes may be a specific role of these genes in the larval stage.

FIGURE 4| Relative expression of delta-6-desaturase (fads2) (A), fatty acid elongase 4 (elovl4b) (B), and fatty acid elongase 5 (elovl5) (C) during the early ontogeny of Petenia splendida. Lowercase letters indicate significant differences in the expression as a function of developmental time (p < 0.05).

Discussion​


Characterization and expression of fasd2, elvol4b, and elvol5 in tissues from P. splendida adults. In our study, we cloned, characterized, and evaluated the relative expression of two genes of the desaturase group (fads) and one of the elongases (elovl) in adults of P. splendida, which are essential for the biosynthesis of low-chain polyunsaturated fatty acids (LC-PUFA) from linolenic acid (LA) and α-linolenic acid (ALA). In this regard, desaturases (FADS) incorporate double bonds in the fatty acid chain, and elongases (ELOVL) elongate the carbon chains of fatty acids, adding two-carbon atom units (Monroig et al., 2018; Galindo et al., 2021). Teleost (modern) fishes have lost the fads1 gene, presenting exclusively fads2, which has diversified to fulfill a bifunctional function such as ∆6∆5 (Castro et al., 2012, 2016), as shown in Nile tilapia (O. niloticus) striped snakehead (Channa striata), Japanese medaka (Oryzias latipes) Osteoglossomorpha (Pantodon buchholzi), zebrafish (Danio rerio) and tambaqui (Colossoma macropomum), white rabbitfish (Siganus canaliculatus), silverfish (Chirostoma estor), tench fish (Tinca tinca), where this enzyme is responsible for the desaturation of PUFA toLC-PUFA(Tanomman et al., 2013; Fonseca-Madrigal et al., 2014; Kuah et al., 2015; Oboh et al., 2017; Lopes-Marques et al., 2018; Ferraz et al., 2019; Garrido et al., 2019, 2020; Li et al., 2019). In contrast, ∆4 fads2 has been reported in several teleost species (Morais et al., 2012, 2015; Fonseca-Madrigal et al., 2014; Kuah et al., 2015; Oboh et al., 2017; Garrido et al., 2019). However, it is essential to emphasize that ∆4 Fads2 is reported in the pituitaries of cichlids, including Oreochromis niloticus, Maylandia zebra, Haplochromis burtoni, and Pundamilia nyererei (Oboh et al., 2017; Li et al., 2020). In fish liver, ∆6-desaturase catalyzes the conversion of fatty acids precursors into n-6 and n-3 series PUFAs. These PUFAs are especially important for fish because they influence the composition of lipids in tissues by incorporating them into phospholipids in cell membranes, affecting their fluidity and permeability, as well as for the development of tissues and organs and the regulation of energy metabolism among other metabolic processes involved in reproduction and tolerance to environmental changes (Xu et al., 2014). Finally, ∆8 desaturases are reported as an intrinsic feature among teleost fishes (Monroig et al., 2011b; Garrido et al., 2019). In the case of elongases, three elovls (elovl2, elovl4, and elovl5)have been reported (Castro et al., 2016). Records of elovl2 expression are studied in Atlantic salmon (Salmo salar)and Danio rerio, and the enzyme elovl2 was cloned and functionally characterized for Atlantic salmon (Hastings et al., 2001; Morais et al., 2009) and later zebrafish Danio rerio (Monroig et al., 2009) and O. mykiss (Gregory, James,2014). In the case of elovl4 in zebrafish, two isoforms, elovl4a, and elovl4b, are recorded; the first is expressed mainly in the brain and the second in the gonads. The elovl4a in zebrafish Danio rerio (Monroig et al., 2010) and elov4b in cobia (R. canadum), Atlantic salmon(S. salar), and rabbitfish (S. canaliculatus) (Carmona-Antoñanzas et al.,2011; Monroig et al., 2011a; Monroig et al., 2012a). Finally, elovl5 has been cloned and characterized in species such as Atlantic salmon (Salmo salar) (Morais et al., 2009), Nile tilapia (Oreochromis niloticus), cobia (Rachycentron canadum) (Zheng et al., 2009), black seabream (Acanthopagrus schlegelii) (Kim et al., 2012), meagre (Argyrosomus regius) (Monroig et al., 2013), rainbow trout (O. mykiss) (Gregory, James, 2014), Nibe croaker Nibea mitsukurii (Kabeya et al., 2015).

According to our study, the intestine was the organ in which the sequences of the desaturase fasd2, elovl4b, and elovl5 elongase genes were obtained in adults of P. splendida. This tissue was selected due to its lipid metabolic capabilities to obtain the partial sequences and was analyzed through phylogenetic trees. The phylogenetic tree indicated a large percentage of identity between the amino acid sequences with the tilapia species (O. niloticus), possibly due to the high phylogenetic relationship that both freshwater cichlids that influences the biosynthetic capacity of LC-PUFA of teleost (Schmitter-Soto, 2007; Galindo et al., 2021; Castillo-Collado et al., 2022). This is consistent with various studies investigating the amino acid sequences of fads and elovl in teleost fish and cichlids such as O. niloticus, M. zebra,and H. burtoni, where they mention that these fish have a long-chain PUFA (LC-PUFA) biosynthesis capacity that is very different from other vertebrates (Oboh et al., 2017; Garrido et al., 2019). This is due to the evolutionary changes that these genes have undergone, such as: conservation of ancestral function, pseudogenization, sub functionalization, and neofunctionalization, causing the modification of amino acids that alter the specificity, affinity, or kinetic properties of the enzymes, as well as the establishment of new protein interactions due to changes in the coding sequence or subcellular localization (Fonseca-Madrigal et al., 2014; Oboh et al., 2017). In the analysis of the expression levels of fasd2 desaturase and elovl4b and elovl5 elongases in the tissues of P. splendida adults, the fasd2 and elovl5 showed the highest level of expression in the liver, followed by the intestine and brain. In the case of elovl4b, the highest expression level was recorded in the testis, were long chain fatty acids (PUFAs) are essential components of phospholipids, which are part of cell membranes, it is closely related to several vital functions such as the formation and maturation of sperm, maintaining the integrity and fluidity of the cell membranes of germ cells. This enzyme plays an important role in the regulation of spermatogenesis (Engel et al., 2020), followed by the intestine, suggests that locally synthesized PUFAs could have specific functions related to intestinal modulation in the cell membrane properties, facilitating dietary lipids absorption and modulate the immune response. Their synthesis in the intestine could be essential to maintain intestinal homeostasis and protect against pathogens and their local synthesis is necessary for growth and renewal of intestinal cells (Xu et al., 2016) due to elongases and desaturases are key enzymes involved in lipoproteins and cholesterol metabolism (Panserat et al., 2009). The expression of elovl4b could vary in response to different diets, allowing fish to adjust the composition of PUFAs in their tissues to adapt to different food sources (Benedito-Palos et al., 2014). Our results are consistent with the studies found in various freshwater fishes such as D. rerio (Monroig et al., 2009),pike silverside(Chirostoma estor) (Fonseca-Madrigal et al., 2014), and tench (Tinca tinca) (Garrido et al., 2020). In the case of marine fish, the opposite is reported. The highest expression of these genes is recorded in the brain of vertebrate species (Castro et al., 2016). In this sense, the increased expression of fasd2 and elovl5 is reflected in the liver because it is the main organ responsible for metabolizing lipids, while the intestine plays a vital role in the absorption and biosynthesis ofLC-PUFA(Monroig et al., 2012b; Garrido et al., 2020; Rodríguez et al., 2022). Several studies in fish mention that fatty acid synthesis in enterocytes was regulated by nutritional factors, precisely the fatty acid composition of the diet, in a manner generally like that of hepatocytes (Fonseca, Madrigal et al., 2006; Monroig et al., 2012a; Morais et al., 2015). Similarly, in the case of elov4b, the highest expression was recorded in the testicle, followed by the intestine. This high expression agrees with the work carried out in the species Danio rerio, Gadus morhua, and Clarias gariepinus, where the highest expression of elov4b is reported in the gonads and retina (Monroig, 2010; Xue et al., 2014; Oboh et al., 2017; Ferraz et al., 2019, 2020; Morais et al., 2020). In this sense, elovl4b participates in the biosynthesis of VLC-PUFA through consecutive elongations of a varied range of shorter-chain PUFAprecursors; these lipids are usually synthesized in the retina and gonads (Oboh et al., 2017). According to our results, the high expression of elovl4b in the testis may be because the testis contains large amounts of VLC-PUFA, essential for phototransduction and male fertility, indicating that males are ready for reproduction (Poulos, 1995; Oboh et al., 2017). In this way, VLC-PUFAS are lipids that are usually synthesized in the retina and testes; this explains why the high expression of elovl4b in the testis may indicate that males are ready for reproduction (Ferraz et al., 2020). The expression of elovl4b was presented in the intestine as well as other species, such as Sparus aurata and Solea senegalensis, where it mentions that adult fishes, both elovl4a and elvol4 bare distributed in all the tissues analyzed, being greater its expression in the brain, retina, and gonads, which are relevant in the synthesis of the LG-PUFA (Zhao et al., 2019; Morais et al., 2020).

Expression of fasd2, elvol4b and elvol5 of P. splendida larvae. According to the results obtained in our study, the levels of fasd2 desaturase, elovl4b, and elovl5 elongases during the initial ontogenyof P. splendida expression were detected from day 0 DAH. This high expression can be attributed to two factors: the first factor may be maternal mRNA, this type of transcript is active in the oocyte maturation process and remains until the early stages of embryogenesis (Fujimura, Okada, 2007; Burggren, Blank, 2009; Treviño et al., 2011; Lubzens et al., 2017; Ahi et al., 2018), the second factor may be due to the different nutrients found in eggs (lipids, fatty acids, free amino acids, minerals, and vitamins) and lipids are found in a higher concentration of neutral lipids stored in oil droplets, while in yolk we find phospholipids and lipovitellins necessary for their structural functions and for the maintenance of metabolic pathways (Ospina-Robles, 2020; Burggren, Blank et al., 2009; Monroig et al., 2010; Castillo-Collado et al., 2022). In the case of fasd2 desaturase and elovl4b and elovl5 elongases, the highest level of expression was detected at 20 dph followed by days 25 and 30 dph; our results agree with the study by Uscanga-Martínez et al. (2011) where they mention that the lipase enzyme activity in the initial ontogeny of Petenia splendida lipase was high at the time of hatching and increased to 15 and 20 dph, after which it gradually decreases due to the lipid inclusions throughout development reflect a high level of lipids contained in the supplied diets (trout diet). These lipids administered in the commercial diet possibly activate the pathway of genes involved in lipid metabolism, associated with morphophysiological processes such as the arrangement between hepatocyte cords and pancreatic acinar tissue, development of the brain, retina, and gonads (Jiménez-Martínez et al., 2019; Zhao et al., 2019; De la Cruz et al., 2021). Similarly, at day 20 dph, the larvae are fully formed with all their functional organs, such as the intestine, liver, brain, eyes, and retina tissues, related to the synthesis of fatty acids coinciding with the same pattern of development as other species of cichlids Oreochromis niloticus, C. urophthalmus, Amphilophus trimaculatus, (Morrison et al., 2001; Monroig et al., 2011b; Cuenca-Soria et al., 2013; Li et al., 2020; Frías-Quintana et al., 2021; Hilerio-Ruiz et al., 2021). Also, in some morphological studies during early ontogeny, lipid accumulation is recorded in the intestinal mucosa, liver, and pancreas, which has been observed in P. splendida larvae when fed a high lipid (16%) trout diet, indicating that although the fish were able to digest and absorb them, they were accumulated in the organisms, so that this diet does not meet the nutritional requirements of early juveniles of this species (Treviño et al., 2011).

Finally, in our applied study of P. splendida in captive organisms, the composition of the diet plays an important role on the expression levels of fasd2 and the elongases elovl4b and elovl5 as reported by Zhao et al. (2023) where the HUFA content in the diet plays an important role in the functional and expression analyses of these genes in different tissues in adults and larvae of common carp (Cyprinus carpio). In addition to the diet, it is important to mention that the expression of fasd2 and the elongases elovl4b and elovl5 can be modified by the habitat, developmental stage, reproductive status, environmental factors, temperature and salinity (Tocher et al., 2015; Garrido et al., 2019; De La Cruz-Alvarado et al., 2021). These factors are not only reflected in captive fish species but are also observed in wild species which are subjected to environmental stress due to anthropogenic pollution mainly by compounds called obesogens in their habitat causing an effect on the decrease of LC-PUFA content in organisms and an effect on transcription factors such as: response element binding proteins (SREBP) and peroxisome proliferator-activated receptors (PPAR) genes that regulate lipid metabolism and the genetic expression of the main pathways for LC-PUFA biosynthesis influencing oxidative stress and chemical toxicity (Zheng et al., 2005; Martins et al., 2012; Liao et al., 2019; Capitão et al., 2017; Koelmel et al., 2020; Gladyshev et al., 2022; Rigaud et al., 2023).

In conclusion, the maximum expression of fasd2 and the elovl4b and elovl5 elongases was detected at 20 dph, followed by 25 and 30 dph days when organogenesis is complete (20 dph), especially in the liver and intestine. Similarly, in adults, P. splendida is expressed mainly in the liver and intestine, organs considered the main metabolic sites for the Novo LC-PUFA biosynthesis in these types of fish. The expression of these genes is relevant for to improve the design of diets and feeds that specifically match the fatty acid biosynthesis capabilities of the P. splendida species.

Acknowledgments​


Gratitude goes to the technician Vicente Garcia Morales, who oversees the DAMC teaching laboratory, for his support in carrying out this research.

References​


Ahi EP, Singh P, Lecaudey LA, Gessl W, Sturmbauer C. Maternal mRNA input of growth and stress-response-related genes in cichlids in relation to egg size and trophic specialization. EvoDevo. 2018; 9(1):23. https://doi.org/10.1186/s13227-018-0112-3

Alvarez González, C.A. et al. 2008. Avances en la Fisiología Digestiva y Nutrición de la Mojarra Tenguayaca Petenia splendida. 135- 235 pp. Editores: L. Elizabeth Cruz Suárez, Denis Ricque Marie, Mireya Tapia Salazar, Martha G. Nieto López, David A. Villarreal Cavazos, Juan Pablo Lazo y Ma. Teresa Viana. Avances en Nutrición Acuícola IX. IX Simposio Internacional de Nutrición Acuícola. 24-27 Noviembre. Universidad Autónoma de Nuevo León, Monterrey, Nuevo León, México.

Arias-Rodriguez L, Ibarra-Castro L, Páramo-Delgadillo S. Los cromosomas mitóticos y meióticos del pez tropical Petenia splendida (Cichlidae). Rev Biol Trop. 2008; 56(2):895–907.

Ayisi CL, Yamei C, Zhao J-L. Genes, transcription factors and enzymes involved in lipid metabolism in fin fish. Agri Gene. 2018; 7:7–14. https://doi.org/10.1016/j.aggene.2017.09.006

Benedito-Palos L, Ballester-Lozano G, Pérez-Sánchez J. Wide-gene expression analysis of lipid-relevant genes in nutritionally challenged gilthead sea bream (Sparus aurata). Gene. 2014; 547(1):34–42. https://doi.org/10.1016/j.gene.2014.05.073

Burggren W, Blank T. Physiological study of larval fishes: challenges and opportunities. Sci Mar. 2009; 73:99–110. https://doi.org/10.3989/scimar.2009.73s1099

Capitão A, Lyssimachou A, Castro LFC, Santos MM. Obesogens in the aquatic environment: an evolutionary and toxicological perspective. Environ Int. 2017; 106:153–69. https://doi.org/10.1016/j.envint.2017.06.003

Carmona-Antoñanzas G, Monroig O, Dick JR, Davie A, Tocher DR. Biosynthesis of very long-chain fatty acids (C> 24) in Atlantic salmon: cloning, functional characterisation, and tissue distribution of an Elovl4 elongase. Comp Biochem Physiol Part B Biochem Mol Biol. 2011; 159(2):122–29. https://doi.org/10.1016/j.cbpb.2011.02.007

Castillo-Collado AC, Frías-Quintana CA, Morales-Garcia V, Alvarez-Villagomez CS, Asencio-Alcudia G, Peña-Marín ES et al. Characterization and expression of the gene glucose transporter 2 (GLUT2) in embryonic, larval and adult Bay snook Petenia splendida (Cichliformes: Cichlidae). Neotrop Ichthyol. 2022; 20(3):e210171. https://doi.org/10.1590/1982-0224-2021-0171

Castro LFC, Monroig O, Leaver MJ, Wilson J, Cunha I, Tocher DR. Functional desaturase Fads1 (Δ5) and Fads2 (Δ6) orthologues evolved before the origin of jawed vertebrates. PLoS ONE. 2012; 7(2):e31950. https://doi.org/10.1371/journal.pone.0031950

Castro LFC, Tocher DR, Monroig O. Long-chain polyunsaturated fatty acid biosynthesis in chordates: insights into the evolution of Fads and Elovl gene repertoire. Prog Lipid Res. 2016; 62:25–40. https://doi.org/10.1016/j.plipres.2016.01.001

Colombo SM, Wacker A, Parrish CC, Kainz MJ, Arts MT. A fundamental dichotomy in long-chain polyunsaturated fatty acid abundance between and within marine and terrestrial ecosystems. Environ Rev. 2017; 25(2):163–74. https://doi.org/10.1139/er-2016-0062

Cuenca-Soria CA. Fisiología digestiva de la mojarra castarrica Cichlasoma urophthalmus (Teleostei: Cichlidae). [PhD Thesis]. La Paz: Instituto Politécnico Nacional, Centro Interdisciplinario de Ciencias Marinas; 2013.

De la Cruz-Alvarado FJ, Álvarez-González CA, Llera-Herrera R, Monroig O, Kabeya N, Rodríguez-Morales S et al. Expression of long-chain polyunsaturated fatty acids biosynthesis genes during the early life-cycle stages of the tropical gar Atractosteus tropicus. Comp Biochem Physiol Part B Biochem Mol Biol. 2021; 256:110628. https://doi.org/https://doi.org/10.1016/j.cbpb.2021.110628

Engel KM, Dzyuba V, Ninhaus-Silveira A, Veríssimo-Silveira R, Dannenberger D, Schiller J et al. Sperm lipid composition in early diverged fish species: internal vs. external mode of fertilization. Biomolecules. 2020; 10(2):172. https://doi.org/10.3390/biom10020172

Fahy E, Cotter D, Sud M, Subramaniam S. Lipid classification, structures and tools. Biochim Biophys Acta. 2011; 1811(11):637–47. https://doi.org/10.1016/j.bbalip.2011.06.009

Ferraz RB, Kabeya N, Lopes-Marques M, Machado AM, Ribeiro RA, Salaro AL et al. A complete enzymatic capacity for long-chain polyunsaturated fatty acid biosynthesis is present in the Amazonian teleost tambaqui, Colossoma macropomum. Comp Biochem Physiol Part B Biochem Mol Biol. 2019; 227:90–97. https://doi.org/10.1016/j.cbpb.2018.09.003

Ferraz RB, Machado AM, Navarro JC, Cunha I, Ozório R, Salaro AL et al. The fatty acid elongation genes elovl4a and elovl4b are present and functional in the genome of tambaqui (Colossoma macropomum). Comp Biochem Physiol Part B Biochem Mol Biol. 2020; 245:110447. https://doi.org/10.1016/j.cbpb.2020.110447

Fonseca-Madrigal J, Bell JG, Tocher DR. Nutritional and environmental regulation of the synthesis of highly unsaturated fatty acids and of fatty-acid oxidation in Atlantic salmon (Salmo salar L.) enterocytes and hepatocytes. Fish Physiol Biochem. 2006; 32:317–28. https://doi.org/10.1007/s10695-006-9109-2

Fonseca-Madrigal J, Navarro JC, Hontoria F, Tocher DR, Martínez-Palacios CA, Monroig O. Diversification of substrate specificities in teleostei Fads2: characterization of Δ4 and Δ6Δ5 desaturases of Chirostoma estor [S]. J Lipid Res. 2014; 55(7):1408–19. https://doi.org/10.1194/jlr.M049791

Fujimura K, Okada N. Development of the embryo, larva and early juvenile of Nile tilapia Oreochromis niloticus (Pisces: Cichlidae). Developmental staging system. Dev Growth Differ. 2007; 49(4):301–24. https://doi.org/10.1111/j.1440-169X.2007.00926.x

Frías-Quintana CA, Jiménez-Martínez LD, Álvarez-González CA, Hernández-Vergara MP, Pérez-Rostro CI. Molecular expression of digestive enzymes during the ontogeny of the Mayan cichlid (Cichlasoma urophthalmus). Aquac Res. 2021; 52(9):4176–83. https://doi.org/https://doi.org/10.1111/are.15256

Galindo A, Garrido D, Monroig O, Perez JA, Betancor MB, Acosta NG et al. Polyunsaturated fatty acid metabolism in three fish species with different trophic level. Aquaculture. 2021; 530:735761. https://doi.org/10.1016/j.aquaculture.2020.735761

Garrido D, Kabeya N, Betancor MB, Pérez JA, Acosta NG, Tocher DR et al. Functional diversification of teleost Fads2 fatty acyl desaturases occurs independently of the trophic level. Sci Rep. 2019; 9(1):11199. https://doi.org/10.1038/s41598-019-47709-0

Garrido D, Monroig O, Galindo A, Betancor MB, Perez JA, Kabeya N et al. Lipid metabolism in Tinca tinca and its n-3 LC-PUFA biosynthesis capacity. Aquaculture. 2020; 523:735147. https://doi.org/10.1016/j.aquaculture.2020.735147

Gladyshev MI, Makhrov AA, Baydarov IV, Safonova, SS, Golod, VM, Alekseyev S et al. Fatty acid composition and contents of fish of genus Salvelinus from natural ecosystems and aquaculture. Biomolecules. 2022; 12(1):144. https://doi.org/10.3390/biom12010144

Gregory MK, James MJ. Rainbow trout (Oncorhynchus mykiss) Elovl5 and Elovl2 differ in selectivity for elongation of omega-3 docosapentaenoic acid. Biochim Biophys Acta (BBA)-Molecular Cell Biol Lipids. 2014; 1841(12):1656–60. https://doi.org/10.1016/j.bbalip.2014.10.001

Hastings N, Agaba M, Tocher DR, Leaver MJ, Dick JR, Sargent JR et al. A vertebrate fatty acid desaturase with Δ5 and Δ6 activities. PNAS. 2001; 98(25):14304–09. https://doi.org/10.1073/pnas.251516598

Hilerio-Ruiz A, Toledo-Solís FJ, Peña E, Martínez-Burguete T, Martínez-García R, Llera-Herrera R et al. Nutrigenomic markers identified by de novo RNAseq during the early ontogeny of the three spot cichlid Amphilophus trimaculatus. Aquaculture. 2021; 530:735654. https://doi.org/https://doi.org/10.1016/j.aquaculture.2020.735654

Jiménez‐Martínez LD, Alvarez‐González CA, Contreras‐Sánchez WM, Márquez‐Couturier G, Arias‐Rodríguez L, Almeida‐Madrigal JA. Evaluation of larval growth and survival in Mexican mojarra, Cichlasoma urophthalmus, and Bay Snook, Petenia splendida, under different initial stocking densities. J World Aquac Soc. 2009; 40(6):753–61. https://doi.org/10.1111/j.1749-7345.2009.00295.x

Jiménez‐Martínez LD, Álvarez‐González CA, De la Cruz‐Hernández E, Tovar‐Ramírez D, Galaviz MA, Camarillo‐Coop S et al. Partial sequence characterization and ontogenetic expression of genes involved in lipid metabolism in the tropical gar (Atractosteus tropicus). Aquac Res. 2019; 50(1):162–72. https://doi.org/10.1111/are.13879

Jiménez-Martínez LD, Morales-Garcia V, Frias-Quintana CA, Castillo-Collado AC, Asencio-Alcudia GG, Alvarez-Villagomez CS et al. Quality evaluation of reference gene expression on different tissues in adults of tropical gar Atractosteus tropicus. Pak J Zool. 2022; 54(1):1–10. https://dx.doi.org/10.17582/journal.pjz/20200913180928

Kabeya N, Yamamoto Y, Cummins SF, Elizur A, Yazawa R, Takeuchi Y et al. Polyunsaturated fatty acid metabolism in a marine teleost, Nibe croaker Nibea mitsukurii: functional characterization of Fads2 desaturase and Elovl5 and Elovl4 elongases. Comp Biochem Physiol Part B Biochem Mol Biol. 2015; 188:37–45. https://doi.org/10.1016/j.cbpb.2015.06.005

Kim SH, Kim JB, Jang YS, Kim SY, Roh KH, Kim HU et al. Isolation and functional characterization of polyunsaturated fatty acid elongase (AsELOVL5) gene from black seabream (Acanthopagrus schlegelii). Biotechnol Lett. 2012; 34:261–68. https://doi.org/10.1007/s10529-011-0746-x

Koelmel JP, Napolitano MP, Ulmer CZ, Vasiliou V, Garrett TJ, Yost RA et al. Environmental lipidomics: understanding the response of organisms and ecosystems to a changing world. Metabolomics. 2020; 16:56. https://doi.org/10.1007/s11306-020-01665-3

Kuah M-K, Jaya-Ram A, Shu-Chien AC. The capacity for long-chain polyunsaturated fatty acid synthesis in a carnivorous vertebrate: functional characterization and nutritional regulation of a Fads2 fatty acyl desaturase with Δ4 activity and an Elovl5 elongase in striped snakehead (Channa striata). Biochim Biophys Acta (BBA)-Molecular Cell Biol Lipids. 2015; 1851(3):248–60. https://doi.org/10.1016/j.bbalip.2014.12.012

Lee JK, Cho SH, Park SU, Kim K, Lee S. Dietary protein requirement for young turbot (Scophthalmus maximus L.). Aquac Nutr. 2003; 9(4):283–86. https://doi.org/10.1046/j.1365-2095.2003.00255.x

Liao K, Ran Z, Meng R, Xu J, Cao J, Xu X et al. Long-chain polyunsaturated fatty acid biosynthesis and its response to cadmium exposure in silver pomfret. Aquat Toxicol. 2019; 206:61–71. https://doi.org/10.1016/j.aquatox.2018.11.002

Li S, Zhang Y, Liu N, Chen J, Guo L, Dai Z et al. Dietary L-arginine supplementation reduces lipid accretion by regulating fatty acid metabolism in Nile tilapia (Oreochromis niloticus). J Anim Sci Biotechnol. 2020; 11:82. https://doi.org/10.1186/s40104-020-00486-7

Li Y, Yin Z, Dong Y, Wang S, Monroig O, Tocher DR et al. Ppary is involved in the transcriptional regulation of liver LC-PUFA biosynthesis by targeting the Δ6Δ5 fatty acyl desaturase gene in the marine teleost Siganus canaliculatus. Mar Biotechnol. 2019; 21:19–29. https://doi.org/10.1007/s10126-018-9854-0

Lopes-Marques M, Kabeya N, Qian Y, Ruivo R, Santos MM, Venkatesh B et al. Retention of fatty acyl desaturase 1 (fads1) in Elopomorpha and Cyclostomata provides novel insights into the evolution of long-chain polyunsaturated fatty acid biosynthesis in vertebrates. BMC Evol Biol. 2018; 18:157. https://doi.org/10.1186/s12862-018-1271-5

Lubzens E, Bobe J, Young G, Sullivan CV. Maternal investment in fish oocytes and eggs: the molecular cargo and its contributions to fertility and early development. Aquaculture. 2017; 472:107–43. https://doi.org/10.1016/j.aquaculture.2016.10.029

Martins DA, Rocha F, Martínez-Rodríguez G, Bell G, Morais S, Castanheira F et al. Teleost fish larvae adapt to dietary arachidonic acid supply through modulation of the expression of lipid metabolism and stress response genes. Br J Nutr. 2012; 108(5):864–74. https://doi.org/10.1017/S0007114511006143

Mejri SC, Tremblay R, Audet C, Wills PS, Riche M. Essential fatty acid requirements in tropical and cold-water marine fish larvae and juveniles. Front Mar Sci. 2021; 8:680003. https://doi.org/10.3389/fmars.2021.680003

Méndez-García CA. Revisión sistemática del complejo Petenia splendida (Teleostei: Cichlidae) en áreas selectas de Guatemala, Centro América. [Master Thesis]. México: Universidad Autónoma de Nuevo León; 2010. Available from: http://eprints.uanl.mx/2209/1/1080191566.pdf

Monroig O, Guinot D, Hontoria F, Tocher DR, Navarro JC. Biosynthesis of essential fatty acids in Octopus vulgaris (Cuvier, 1797): molecular cloning, functional characterizations and tissue distribution of a fatty acyl elongase. Aquaculture. 2012a; 360:45–53. https://doi.org/10.1016/j.aquaculture.2012.07.016

Monroig O, Kabeya N. Desaturases and elongases involved in polyunsaturated fatty acid biosynthesis in aquatic invertebrates: a comprehensive review. Fish Sci. 2018; 84:911–28. https://doi.org/10.1007/s12562-018-1254-x

Monroig O, Li Y, Tocher DR. Delta-8 desaturation activity varies among fatty acyl desaturases of teleost fish: high activity in delta-6 desaturases of marine species. Comp Biochem Physiol Part B Biochem Mol Biol. 2011a; 159(4):206–13. https://doi.org/10.1016/j.cbpb.2011.04.007

Monroig O, Rotllant J, Cerdá-Reverter JM, Dick JR, Figueras A, Tocher DR. Expression and role of Elovl4 elongases in biosynthesis of very long-chain fatty acids during zebrafish Danio rerio early embryonic development. Biochim Biophys Acta. 2010; 1801(10):1145–54. https://doi.org/10.1016/j.bbalip.2010.06.005

Monroig O, Rotllant J, Sánchez E, Cerdá-Reverter JM, Tocher DR. Expression of long-chain polyunsaturated fatty acid (LC-PUFA) biosynthesis genes during zebrafish Danio rerio early embryogenesis. Biochim Biophys Acta. 2009; 1791(11):1093–101. https://doi.org/10.1016/j.bbalip.2009.07.002

Monroig O, Tocher DR, Navarro JC. Biosynthesis of polyunsaturated fatty acids in marine invertebrates: recent advances in molecular mechanisms. Mar Drugs. 2013; 11(10):3998–4018. https://doi.org/10.3390/md11103998

Monroig O, Wang S, Zhang L, You C, Tocher DR, Li Y. Elongation of long-chain fatty acids in rabbitfish Siganus canaliculatus: cloning, functional characterisation and tissue distribution of Elovl5-and Elovl4-like elongases. Aquaculture. 2012b; 350:63–70. https://doi.org/10.1016/j.aquaculture.2012.04.017

Monroig O, Shu-Chien A-C, Kabeya N, Tocher DR, Castro LFC. Desaturases and elongases involved in long-chain polyunsaturated fatty acid biosynthesis in aquatic animals: From genes to functions. Prog Lipid Res. 2022; 86:101157. https://doi.org/10.1016/j.plipres.2022.101157

Monroig O, Webb K, Ibarra-Castro L, Holt GJ, Tocher DR. Biosynthesis of long-chain polyunsaturated fatty acids in marine fish: characterization of an Elovl4-like elongase from cobia Rachycentron canadum and activation of the pathway during early life stages. Aquaculture. 2011b; 312(1–4):145–53. https://doi.org/10.1016/j.aquaculture.2010.12.024

Morais S, Castanheira F, Martinez-Rubio L, Conceição LEC, Tocher DR. Long chain polyunsaturated fatty acid synthesis in a marine vertebrate: ontogenetic and nutritional regulation of a fatty acyl desaturase with Δ4 activity. Biochim Biophys Acta. 2012; 1821(4):660–71. https://doi.org/10.1016/j.bbalip.2011.12.011

Morais S, Monroig O, Zheng X, Leaver MJ, Tocher DR. Highly unsaturated fatty acid synthesis in Atlantic salmon: characterization of ELOVL5-and ELOVL2-like elongases. Mar Biotechnol. 2009; 11:627–39. https://doi.org/10.1007/s10126-009-9179-0

Morais S, Mourente G, Martínez A, Gras N, Tocher DR. Docosahexaenoic acid biosynthesis via fatty acyl elongase and Δ4-desaturase and its modulation by dietary lipid level and fatty acid composition in a marine vertebrate. Biochim Biophys Acta. 2015; 1851(5):588–97. https://doi.org/10.1016/j.bbalip.2015.01.014

Morais S, Torres M, Hontoria F, Monroig O, Varó I, Agulleiro MJ et al. Molecular and functional characterization of Elovl4 genes in Sparus aurata and Solea senegalensis pointing to a critical role in very long-chain (>C24) fatty acid synthesis during early neural development of fish. Int J Mol Sci. 2020; 21(10):3514. https://doi.org/10.3390/ijms21103514

Morrison CM, Miyake T, Wright JR. Histological study of the development of the embryo and early larva of Oreochromis niloticus (Pisces: Cichlidae). J Morphol. 2001; 247(2):172–95. https://doi.org/10.1002/1097-4687(200102)247:2%3C172::AID-JMOR1011%3E3.0.CO;2-H

Oboh A, Navarro JC, Tocher DR, Monroig O. Elongation of very long-chain (> C24) fatty acids in Clarias gariepinus: cloning, functional characterization and tissue expression of elovl4 elongases. Lipids. 2017; 52:837–48. https://doi.org/10.1007/s11745-017-4289-3

Ospina-Robles MF. Perfil de ácidos grasos, proteínas y lípidos en diferentes estadios del desarrollo embrionario-larvario en trucha arco iris, (Oncorhynchus mykiss Walbaun, 1972) y su relación con análisis morfométricos e índices de eficiencia. [Master Thesis]. Bogotá: Universid De La Salle; 2020. Available from: https://ciencia.lasalle.edu.co/server/api/core/bitstreams/17dd159b-9253-4e0e-a588-442d5de03727/content

Panserat S, Hortopan GA, Plagnes-Juan E, Kolditz C, Lansard M, Skiba-Cassy S, Corraze G. Differential gene expression after total replacement of dietary fish meal and fish oil by plant products in rainbow trout (Oncorhynchus mykiss) liver. Aquaculture. 2009; 294(1–2):123–31. https://doi.org/10.1016/j.aquaculture.2009.05.013

Pérez-Sánchez E, Páramo‐Delgadillo S. The culture of cichlids of southeastern Mexico. Aquac Res. 2008; 39(7):777–83. https://doi.org/10.1111/j.1365-2109.2008.01929.x

Pfaffl MW. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001; 29(9):e45. https://doi.org/10.1093/nar/29.9.e45

Poulos A. Very long chain fatty acids in higher animals—a review. Lipids. 1995; 30(1):1–14. https://doi.org/10.1007/BF02537036

Rigaud C, Kahilainen KK, Calderini ML, Pilecky M, Kainz MJ, Tiirola M et al. Preparing for the future offspring: European perch (Perca fluviatilis) biosynthesis of physiologically required fatty acids for the gonads happens already in the autumn. Oecologia. 2023; 203(3):477–89. https://doi.org/10.1007/s00442-023-05480-0

Rodrı́guez C, Pérez JA, Henderson RJ. The esterification and modification of n-3 and n-6 polyunsaturated fatty acids by hepatocytes and liver microsomes of turbot (Scophthalmus maximus). Comp Biochem Physiol Part B Biochem Mol Biol. 2002; 132(3):559–70. https://doi.org/10.1016/S1096-4959(02)00072-6

Rodríguez-Estrada U, Méndez-Marín O, Pérez-Morales A, Martínez-García R, Peña-Marín E, Civera-Cerecedo R et al. Lipid requirement of bay snook (Petenia splendida Günther, 1862) juveniles. Lat Am J Aquat Res. 2020; 48(4):674–85. http://dx.doi.org/10.3856/vol48-issue4-fulltext-2429

Schmitter-Soto JJ. Phylogeny of species formerly assigned to the genus Archocentrus (Perciformes: Cichlidae). Zootaxa. 2007; 1618(1):1–50. https://doi.org/10.11646/zootaxa.1618.1.1

Takeuchi T. Essential fatty acid requirements of aquatic animals with emphasis on fish larvae and fingerlings. Rev Fish Sci. 1997; 5(1):1–25. https://doi.org/10.1080/10641269709388592

Tanomman S, Ketudat-Cairns M, Jangprai A, Boonanuntanasarn S. Characterization of fatty acid delta-6 desaturase gene in Nile tilapia and heterogenous expression in Saccharomyces cerevisiae. Comp Biochem Physiol B Biochem Mol Biol. 2013; 166(2):148–56. https://doi.org/10.1016/j.cbpb.2013.07.011

Tocher DR. Omega-3 long-chain polyunsaturated fatty acids and aquaculture in perspective. Aquaculture. 2015; 449:94–107. https://doi.org/10.1016/j.aquaculture.2015.01.010

Treviño L, Alvarez-González CA, Perales-García N, Arévalo-Galán L, Uscanga-Martínez A, Márquez-Couturier G et al. A histological study of the organogenesis of the digestive system in bay snook Petenia splendida Günther, 1862 from hatching to the juvenile stage. J Appl Ichthyol. 2011; 27(1):73–82. https://doi.org/https://doi.org/10.1111/j.1439-0426.2010.01608.x

Uscanga-Martínez A, Perales-García N, Álvarez-González CA, Moyano FJ, Tovar-Ramírez D, Gisbert GE et al. Changes in digestive enzyme activity during initial ontogeny of bay snook Petenia splendida. Fish Physiol Biochem. 2011; 37:667–80. https://doi.org/10.1007/s10695-011-9467-2

Vidal-López JM, Álvarez-González CA, Contreras-Sánchez WM, Hernández-Vidal U. Masculinización del cíclido nativo Tenhuayaca, Petenia splendida (Günther, 1862), usando nauplios de Artemia como vehículo del esteroide 17-α metiltestosterona. Hidrobiológica. 2009; 19(3):211–16.

Xu H, Dong X, Ai Q, Mai K, Xu W, Zhang Y et al. Regulation of tissue LC-PUFA contents, Δ6 fatty acyl desaturase (FADS2) gene expression and the methylation of the putative FADS2 gene promoter by different dietary fatty acid profiles in Japanese seabass (Lateolabrax japonicus). PLoS ONE. 2014; 9(1):e87726. https://doi.org/10.1371/journal.pone.0087726

Xu H, Wang J, Mai K, Xu W, Zhang W, ZhangY et al. Dietary docosahexaenoic acid to eicosapentaenoic acid (DHA/EPA) ratio influenced growth performance, immune response, stress resistance and tissue fatty acid composition of juvenile Japanese seabass, Lateolabrax japonicus (Cuvier). Aquac Res. 2016; 47(3):741–57. https://doi.org/10.1111/are.12532

Xue X, Feng CY, Hixson SM, Johnstone K, Anderson DM, Parrish CC et al. Characterization of the fatty acyl elongase (elovl) gene family, and hepatic elovl and delta-6 fatty acyl desaturase transcript expression and fatty acid responses to diets containing camelina oil in Atlantic cod (Gadus morhua). Comp Biochem Physiol Part B Biochem Mol Biol. 2014; 175:9–22. https://doi.org/10.1016/j.cbpb.2014.06.005

Zhao N, Monroig O, Navarro JC, Xiang X, Li Y, Du J et al. Molecular cloning, functional characterization and nutritional regulation of two elovl4b elongases from rainbow trout (Oncorhynchus mykiss). Aquaculture. 2019; 511:734221. https://doi.org/https://doi.org/10.1016/j.aquaculture.2019.734221

Zhao R, Yang C-R, Wang Y-X, Xu Z-M, Li S-Q, Li J-C et al. Fads2b plays a dominant role in∆ 6/∆ 5 desaturation activities compared with Fads2a in common carp (Cyprinus carpio). Int J Mol Sci. 2023; 24(13):10638. https://doi.org/10.3390/ijms241310638

Zheng X, Torstensen BE, Tocher DR, Dick JR, Henderson RJ, Bell JG. Environmental and dietary influences on highly unsaturated fatty acid biosynthesis and expression of fatty acyl desaturase and elongase genes in liver of Atlantic salmon (Salmo salar). Biochim Biophys Acta. 2005; 1734(1):13–24. https://doi.org/10.1016/j.bbalip.2005.01.006

Zheng X, Ding Z, Xu Y, Monroig O, Morais S, Tocher DR. Physiological roles of fatty acyl desaturases and elongases in marine fish: characterisation of cDNAs of fatty acyl Δ6 desaturase and elovl5 elongase of cobia (Rachycentron canadum). Aquaculture. 2009; 290(1–2):122–31. https://doi.org/10.1016/j.aquaculture.2009.02.010

Zhu K-C, Song L, Guo H-Y, Guo L, Zhang N, Liu B-S et al. Identification of fatty acid desaturase 6 in golden pompano Trachinotus ovatus (Linnaeus 1758) and its regulation by the PPARαb transcription factor. Int J Mol Sci. 2018; 20(1):23. https://doi.org/10.3390/ijms20010023

Authors


Luis Daniel Jiménez-Martínez1 , Gloria Gertrudys Asencio-Alcudia2, Carlos Alfonso Álvarez-González2, Alejandra del C. Castillo-Collado1, Vicente Morales-Garcia3, Carina Shianya Alvarez-Villagomez2, Candelario Rodríguez-Pérez1, Rafael Martínez-García2, César Sepúlveda-Quiroz2,4 and Graciela María Pérez-Jiménez2

[1]    Laboratorio de Biología Molecular. DAMJM-UJAT, Jalpa de Méndez, Tabasco, Mexico. (LDJM) luisd1984@hotmail.com (corresponding author), (ACCC) 162S1053@egresados.ujat.mx, (CRP) potencia_rguez@hotmail.com.

[2]    Laboratorio de Fisiología en Recursos Acuáticos, DACBIOL-UJAT, Villahermosa, Mexico. (GGAA) yoya_asencio@live.com.mx, (CAAG) alvarez_alfonso@hotmail.com, (CSAV) carina.alvarez@ujat.mx, (RMG) biologomartinez@hotmail.com, (CSQ) casq15@gmail.com, (GMPJ) gjimenez9@outlook.com.

[3]    Laboratorio de Docencia DAMC-UJAT, Ranchería Sur Cuarta Sección, Comalcalco, Mexico. (VMG) almostmaster@live.com.mx.

[4]    Tecnológico Nacional de México Campus Villahermosa, Km 3,5 Carretera Villahermosa-Frontera, Cd. Industrial, Villahermosa CP 86010, Tabasco, Mexico.

Authors’ Contribution


Luis Daniel Jiménez-Martínez: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Resources, Supervision, Visualization, Writing-original draft, Writing-review and editing.

Gloria Gertrudys Asencio-Alcudia: Conceptualization, Data curation, Investigation, Methodology, Resources, Validation, Writing-review and editing.

Carlos Alfonso Álvarez-González: Project administration, Resources, Software, Supervision, Validation, Visualization, Writing-original draft, Writing-review and editing.

Alejandra del Carmen Castillo-Collado: Data curation, Formal analysis, Investigation, Supervision, Visualization.

Vicente Morales-Garcia: Conceptualization, Data curation, Investigation, Methodology, Project administration, Resources.

Carina Shianya Alvarez-Villagomez: Visualization, Writing-original draft, Writing-review and editing.

Candelario Rodríguez-Pérez: Conceptualization, Formal analysis, Investigation, Methodology.

Rafael Martínez-García: Visualization, Writing-original draft, Writing-review and editing.

César Sepúlveda-Quiroz: Conceptualization, Methodology, Validation.

Graciela María Pérez-Jiménez: Investigation, Methodology, Supervision.

Ethical Statement​


Animals were handled in compliance with the Norma Oficial Mexicana NOM-062-ZOO-1999 from the Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentación, the Mexican standard for good welfare practices for laboratory animals.

Competing Interests


The author declares no competing interests.

How to cite this article


Jiménez-Martínez LD, Asencio-Alcudia GG, Álvarez-González CA, Castillo-Collado AC, Morales-Garcia V, Alvarez-Villagomez CS, Rodríguez-Pérez C, Martínez-García R, Sepúlveda-Quiroz C, Pérez-Jiménez GM. Molecular cloning and gene expression of desaturases and elongases in embryos, larvae, and adults of bay snook Petenia splendida (Cichliformes: Cichlidae). Neotrop Ichthyol. 2025; 23(1):e240095. https://doi.org/10.1590/1982-0224-2024-0095


This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Distributed under

Creative Commons CC-BY 4.0

© 2025 The Authors.

Diversity and Distributions Published by SBI

Accepted January 15, 2025 by Bernardo Baldisserotto

Submitted January 24, 2024

Epub April 18, 2025