Epinephelus itajara (Lichtenstein, 1822), also known as the Atlantic goliath grouper, is the largest grouper species in the Atlantic Ocean and inhabits marine and estuarine habitats (Koenig et al., 2007). The species can live up to 37 years (Sadovy, Eklund, 1999) and reach 2.5 m (total length, TL) in size and 320 kg (Heemstra, Randall, 1993). Currently, E. itajara is classified globally as Vulnerable (VU) according to the International Union for Conservation of Nature – IUCN (Bertoncini et al., 2018). However, in Brazilian waters, the species remains classified as Critically Endangered (CR) (ICMBio, 2018).

The Atlantic goliath grouper was the first marine fish species to receive a specific fishing ban in Brazil (Hostim-Silva et al., 2005) and has been fully protected in Brazilian jurisdictional waters for over 20 years. The first ordinance was set in place in 2002 (Ordinance N° 121/2002 – IBAMA, 2002) and protected the species for five years, after that, the ordinance was renewed in 2007 (Ordinance 42/2007 – IBAMA, 2007), in 2012 (Ordinance 13/2012 – MMA/MPA, 2012), and last in 2015 (Ordinance 13/2015 – MMA/MPA, 2015) protecting the species until 2023 when the species conservation status will be reevaluated.

This iconic species suffered a severe population decline due to increasing fishing pressure along its geographical distribution areas, potentially increased by a vulnerability associated with its biological and behavioral characteristics. Similar to other Epinephelidae, E. itajara is known as slow-growing, long-lived, late maturing, and forming spawning aggregations (Sadovy, Eklund, 1999; Koenig et al., 2007), which added to the loss and/or fragmentation of habitats and the effects caused by the contamination of these environments (Koenig et al., 2011) make E. itajara particularly vulnerable to overfishing (Giglio et al., 2018).

Despite being protected in Brazilian waters, the species is still being harvested and marketed along the Brazilian Coast, especially in Northern Brazil (Silva-Oliveira et al., 2008; Giglio et al., 2014; Pereira et al., 2016; Matos et al., 2021). The biggest problem encountered in complying with the legislation is the difficulty of enforcement since the distribution area of the species along the Brazilian coast is more than 7,000 km. Besides the extensive territory and insufficient enforcement (Pereira et al., 2016, 2020), the Northern Brazilian Coast faces additional challenges, such as difficult access for enforcement agencies, resulting in an inadequate inspection process (Matos et al., 2021; Oliveira et al., 2021).

Once you find markets that commercialize endangered fish, another difficulty is in identifying the species, as most of the time fish are mischaracterized (e.g., filet, cut shape, without skin, and others), making it challenging for law enforcement to inspect and identify the illegal capture and commercialization of E. itajara and other threatened fish species(ICMBio, 2018). To solve this problem in the identification and commercialization of endangered species, molecular techniques started to be used (Bartlett, Davidson, 1991; Holmes et al., 2009; Damasceno et al., 2016; Sharrad et al., 2023). In this context, accurate species identification by applying molecular techniques represents an important tool for monitoring and inspecting fisheries (Oliveira et al., 2021). These include the use of DNA barcoding which has proven to be an important instrument and plays a key role in identifying species accurately (Hebert et al., 2003; Damasceno et al., 2016) at different life stages and even incomplete specimens and mischaracterized individuals (Basheer et al., 2014; Feitosa et al., 2018; Matos et al., 2021). This methodology has also proved to be helpful in identifying mislabeled fish products (Calegari et al., 2020) and illegal catches of protected species (Almerón-Souza et al., 2018; Matos et al., 2021). The DNA barcoding technique is a fast, safe, and robust output based on the Cytochrome c oxidase subunit I (COI) gene and has been extensively used for the identification of marine fish at the species level worldwide (Ward et al., 2005; Damasceno et al., 2016; Fadli et al., 2021; Vences et al., 2022).

Given the Atlantic goliath grouper status in Brazil, the need to preserve its stocks, and the difficulty of illegal fishing control (even after more than 20 years of the fishing ban prohibiting its capture), the present study used DNA barcoding, a valid tool to demonstrate mislabeling and illegal fishing, to analyze samples collected at fish markets in the northern and southern Brazilian coasts to identify the illegal commercialization of the species.

Sample collection. To test if the morphological and molecular identification of the species would match and to see how the analyzed samples would group in the tree clusters with the sequences downloaded from GenBank® we collected samples from whole morphologically identified individuals (n = 2) that dyed from being trapped at an oyster farming in the municipality of Curuçá in the State of Pará, these samples were used as control and were not used in the analyses. Sampling was conducted in fish markets on the northern (NC) and southern (SC) Brazilian coasts (Fig. 1). In the NC samples were collected in Pará from April to July 2019 (Bragança n = 20). In the SC samples were collected in São Paulo in April 2022 (Cananéia n = 1) and in Paraná from February to March 2022 (Paranaguá n = 1 and Curitiba n = 4).

Sampling aimed to confirm the identification of fish that was mischaracterized and being sold as E. itajara in the NC, as well as identifying fish fillets that were being sold as the Dusky grouper (Epinephelus marginatus (Lowe, 1834)), in the SC. Samples were fixed in 96% ethanol placed in a 1 mL microcentrifuge tube and stored at -20 ◦C at the Laboratório de Genética e Conservação Animal at the Universidade Federal do Espírito Santo (UFES) for further processing.

DNA extraction, primer, and PCR assay. Approximately ~25 mg of each tissue sample was used for total genomic DNA extraction using the DNeasy Blood & Tissue Kit (Qiagen, Brazil). Extracted DNA samples were stored at -20 ºC until further amplification processing was implemented.

The Cytochrome c oxidase subunit I (COI) gene was amplified by PCR using the universal primer set FishF1 5’TCAACCAACCACAAAGACATTGGCAC3’ and FishR2 5’ACTTCAGGGTGACCGAAGAATCAGAA3’ (Ward et al., 2005). The amplifications were performed in 20 μl mixture reactions containing 10X buffer; 3.125 mM of MgCl2 (50 mM); 0.125 μM of each primer (10 mM), 0.05 μM of each dNTP (10 mM); 0.625 U of Taq polymerase and 20 ng of DNA template. Thermocycling conditions consisted of an initial denaturation at 95 ºC for 2 min followed by 35 cycles of denaturation at 94 °C for 30 s; annealing at 54 °C for 30 s; and elongation at 72 °C for 1 min; followed by a final 72 °C extension for 10 min.

Gel electrophoresis, staining, and DNA sequencing. The amplified fragments were separated and visualized on a 1% agarose gel. Three μL of PCR product stained with bromophenol blue and 2 μL of GelRed™ were loaded onto 1% agarose gel, along with a 100 bp DNA ladder, and electrophoresed to assess the quality of amplicons. The gel was visualized and photo-documented using a transilluminator. The remaining PCR product was purified using 1.8 μL of ExoSap-IT enzyme (USB Corporation), and the purified PCR products were sent to bidirectional sequencing using Big Dye chemistry with capillary electrophoresis in an ABI 3730xl DNA Analyzer (Seoul, KR).

Molecular data analysis. All molecular data analyses were performed with the software MEGA X (Kumar et al., 2018). Forward and reverse sequences were aligned using MUSCLE with the default settings, manually edited, and translated into protein to ensure accurate alignment and detection of stop codons, if present. The sequences’ similarity was compared with the sequences available in the Barcode of Life Online Database (BOLD) (http://www.boldsystems.org/) (Ratnasingham, Hebert, 2007) and the Basic Local Alignment Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) from GenBank® (Benson et al., 2017). A threshold of > 98 % identity was set for all sequences during identification (Hebert et al., 2003; Wainwright et al., 2018).

The Neighbor-Joining (NJ) methodology is the standard method adopted for phylogenetic inference in DNA barcoding studies (Hebert et al., 2003), and one of the reasons it is used in DNA barcoding studies is because of the capability of analyzing large species assemblages at once (Kumar, Gadadkar, 2000). Therefore, the evolutionary history was inferred by generating an NJ tree (Saitou, Nei, 1987) with 10,000 bootstrap pseudoreplications (Felsenstein, 1985). The evolutionary distances were computed using the Kimura 2-parameter (K2P) substitution model (Kimura, 1980), the most commonly used and standard model in DNA barcoding studies.

To construct the phylogenetic NJ tree, we added COI sequences available on GenBank to make sure that the specific taxa identified from the samples collected in this study would separate into specific clusters. The downloaded sequences were: E. itajara (family Epinephelidae; KF836456); E. marginatus (family Epinephelidae; KC500686); Hyporthodus niveatus (Valenciennes, 1828) (family Epinephelidae; KF836478 and KF836483); Mycteroperca bonaci (Poey, 1860) (family Epinephelidae; JQ841289 and KF836486); Conodon nobilis (Linnaeus, 1758) (family Haemulidae; JQ365304); and Conodon serrifer Jordan & Gilbert, 1882 (family Haemulidae; JQ741172 and JQ741174). The confidence of the branches was verified by Bootstrap (10.000 repetitions; Felsenstein, 1985). Centropomus undecimalis (Bloch, 1792) (family Centropomidae; JQ365276) sequence was used as an outgroup to root the tree.

The control samples collected from the whole individuals morphologically identified as E. itajara in the municipality of Curuçá in the State of Pará were confirmed by DNA barcoding as E. itajara (Tab. 1). The results of the BLAST and BOLD searches showed that from the 26 sequences from samples collected at fish markets, 22 were identified at the species level (Tab. 1), while four sequences from the municipality of Bragança (NC) were under the threshold identity, due to sequence quality, and were not used in further analyses. From the 16 analyzed samples of fish being sold as E. itajara in the State of Pará, only one was not E. itajara and was confirmed to be Conodon nobilis. The sample collected in the State of São Paulo that was being sold as Dusky grouper was E. itajara, while from the five samples that were being sold as Dusky grouper (n = 5) in the State of Paraná, one was confirmed to be E. itajara and the other four samples were confirmed to be theDusky grouper Epinephelus marginatus (Tab. 1). Therefore, from the 22 analyzed samples collected in fish markets during our study, 17 (77.3%) belonged to E. itajara.

Stop codons were not detected and the read lengths varied from 635 to 819 bp. For E. itajara and E. marginatus, the average nucleotide composition was G = 18.42%, C = 27.30%, A = 24.04%, and T = 30.24%, 486 conserved sites, 158 variable sites, 80 parsimony informative sites and 78 singletons (Tab. 2). The mean GC content was 45.72 ± 1.03% (Tab. 2) and decreased from the first codon position down to the third codon position. For Conodon nobilis the average nucleotide composition was G = 20.2%, C = 30.7%, A = 21.1%, and T = 28.0%, while the GC content was 50.9%, and decreased from the first to the second codon position and increased from the second to the third position.

Thirty-four congruent sequences, 24 from this study (22 from fish markets and two used as control) and 10 downloaded from GenBank were used for phylogenetic analysis and the NJ tree showed consistent clusters of conspecific sequences. All clusters were monophyletic and inter-genera relationships between E. itajara and E. marginatus and C. nobilis and Conodon serrifer were well resolved with high bootstrap values (Fig. 2), showing the efficiency of COI sequences to provide species-level resolution.

Our study reveals that besides being protected in Brazil, E. itajara was commercialized in the sampled areas. These illegal fishing practices have been causing a huge loss for Atlantic goliath grouper recovery for two main reasons: first, the capture of younger specimens in estuarine areas negatively affects the recruitment of juveniles for the adult phase, and second, offshore fishing efforts typically concentrate on the largest and oldest individuals, principally at spawning aggregation sites, because they are more valuable economically.

Groupers form one of the most commercially valuable fish groups globally (Fadli et al., 2021), for they are highly admired due to their delicate, desirable taste and flavor (Alcantara, Yambot, 2014). Studies have shown that the fisheries directed to E. itajara coincide with spawning aggregations in austral summer, which take place from December to March (Giglio et al., 2014, 2016; Bueno et al., 2016; Matos et al., 2021), and illegally captured fish are mischaracterized (head, fins, and skin are removed) for commercialization (Silva-Oliveira et al, 2008; Pereira et al., 2020), however, during our study Atlantic goliath grouper samples were also collected from April to July, showing that the fishing pressure is not limited to the spawning aggregation period.

Previous studies have identified fish mislabeling for endangered elasmobranch species in the State of Pará (Palmeira et al., 2013; Wosnick et al., 2023). In our study, although fish were mischaracterized in the State of Pará, sellers would discretely inform customers that the fish being sold was E. itajara. The reality of the State of Pará is different from the states of São Paulo and Paraná, where fish is often mischaracterized and sold as other species, for example, the Dusky grouper E. marginatus. In this case, two crimes are being committed, the illegal sale of E. itajara and commercial fraud by the substitution of one species for another (Matos et al., 2021). The current study surveyed two areas along the Brazilian coast and 77.3% of the samples analyzed were confirmed as E. itajara, showing that besides being protected for over 20 years on the Brazilian coast, E. itajara is still being captured and commercialized, a practice that hampers conservation efforts, such as the initiatives proposed by Meros do Brasil Project (merosdobrasil.org).

Intense fishing has a negative impact on population maintenance, resulting in severe truncation of the population size and age structure (Hixon et al., 2014; Bentes et al., 2019), it can also induce evolutionary responses in fish to reproduce at a smaller size to increase reproductive success, which also increases the risk of mortality (Waples, Audzijonyte, 2016; Marshall et al., 2019). Although fisheries models have traditionally assumed that many small, young, mature females are reproductively equivalent to fewer big, old, fat, fecund, female, fish, known as BOFFFFs, the reproductive output of larger fish is higher than that of smaller fish, especially in long-lived species with low natural mortality (Hixon et al., 2014; Dick et al., 2017) such as the Atlantic goliath grouper.

Furthermore, the issue that arises from the illegal commercialization of E. itajara is not only one of conservation, but it may also have potential implications for consumer health, due to heavy metal bioaccumulation. Several studies have addressed the high concentration of mercury in Atlantic goliath grouper muscle tissue in the United States (Adams et al., 2003; Adams, Sonne, 2013; Malinowski, 2019) and Belize (Evers et al., 2009). Mercury is a heavy metal known to be a severe stressor in wildlife, including fish species (Dietz et al., 2019) as it is one of the most toxic and persistent heavy metals to all organs and tissues (Adams, Sonne, 2013; Malinowski, 2019), therefore, the regular consumption of Atlantic goliath grouper should raise concerns (Evers et al., 2009).

Here we illustrate that DNA barcoding was effective at producing sequences that identified taxonomical units to species-level resolution for the authentication of fish illegally commercialized in local fishing markets on the northern and southern Brazilian coasts. Our dataset computed GC content (or Guanine-cytosine content) mean was 45.92%, being similar to the values reported for groupers from Indonesia (46.28%; Fadli et al., 2021), the Philippines (45.16%; Alcantara, Yambot, 2014) and India (45.17%; Sachithanandam et al., 2022). The distribution of GC content is essential for assessing genetic diversity and population health and can be a useful tool for comprehending fundamental processes and can be linked to features associated with species’ life history traits (Wu et al., 2012; Alcantara, Yambot, 2014), however, environmental elements including genome size, temperature, oxygen need, and habitat can be linked to the mechanism of GC content variation in different species (Wu et al., 2012; Alcantara, Yambot, 2014; Sachithanandam et al., 2022).

Our results show that the laws that protect the Atlantic goliath grouper in Brazil are not effective in identifying illegal catches (Torres et al., 2013), and as a result, the species is still facing fishing pressure and exposure to overexploitation and depletion; especially during spawning aggregation events (Silva-Oliveira et al., 2008; Bueno et al., 2016; Giglio et al., 2017; Pereira et al., 2020; Bravo-Calderon et al., 2021), an ecological trait that contributes to the vulnerability of the species to fishing. These findings highlight that it is necessary to strengthen enforcement and awareness efforts to ensure compliance with protective regulations.

The inspection difficulties faced by public authorities due to mischaracterized individuals and the large extension of the Brazilian coast present a complex and delicate management challenge for the Atlantic goliath grouper, consequently, conservation efforts and recovery plans that require a multitude of comprehensive actions are required to ensure the species protection. Therefore, considering E. itajara vulnerability to extinction (de Mitcheson et al., 2012; Bravo-Calderon et al., 2021), our results are important to raise awareness of its protection, once consumer awareness is essential for preventing the commercialization of endangered species and protecting biodiversity.

The world is experiencing a global trend of sustainable consumption (Mitchell, 2011; Simeone, Scarpato, 2020), and some consumers may refrain from purchasing threatened species if they are aware of how their decision will affect the ecosystem (Guillen et al., 2019), thus, informed consumers might play a significant role in the conservation of endangered species, such as the Atlantic goliath grouper. As a result, it is wise to educate and engage people in conservation initiatives, as this is an important asset for successful management and biodiversity protection.