Mislabeling, illegal capture, and commercialization of Atlantic goliath grouper (Epinephelus itajara) on the Brazilian coast using DNA barcoding

Lorena Lopes Almeida1,2,3 , Maurício Hostim-Silva1,3,4,5, Mario Vinicius Condini3,4, Matheus Oliveira Freitas5, Leonardo Schlögel Bueno5, Bianca Bentes6, Luciano de Jesus Gomes Pereira6 and Ana Paula Cazerta Farro1,2,4

PDF: EN    XML: EN | Cite this article

Abstract​


EN

The Atlantic goliath grouper Epinephelus itajara is the largest grouper species in the Atlantic Ocean. Despite the conservation status being Vulnerable (VU) globally and Critically Endangered (CR) in Brazil, the species continues to face threats from overfishing throughout its range. We used DNA barcoding employing the mitochondrial Cytochrome c oxidase subunit I (COI) gene to identify the illegal commercialization of E. itajara in fish markets from the northern (NC) and southern (SC) Brazilian coasts. Sampling was conducted in fish markets and aimed to confirm the identification of mischaracterized fish sold as E. itajara in the NC, as well as identifying fish fillets sold as the Dusky grouper in the SC. DNA barcoding allowed the unambiguous identification of 22 (84.6%) of the 26 analyzed fish market samples. Both sampled areas had confirmation of E. itajara illegal commercialization and from the 22 analyzed samples, 17 (77.3%) were confirmed to be E. itajara. Here we report two crimes, the illegal sale of E. itajara and commercial fraud by species substitution. This study has highlighted that the existing legislation that protects E. itajara in Brazilian waters requires the adoption of better public policies for the conservation of the species.

Keywords: COI, Endangered species, Illegal fisheries, Molecular identification, Species substitution.

PT

O mero do Atlântico Epinephelus itajara é a maior espécie de garoupa no Oceano Atlântico. Apesar do seu status de conservação Vulnerável (VU) globalmente e Criticamente em Perigo (CR) no Brasil, a espécie continua enfrentando ameaças da sobrepesca em toda a sua área de distribuição. Utilizamos o sequenciamento de DNA por código de barras, empregando o gene mitocondrial da Citocromo c oxidase subunidade I (COI), para identificar a comercialização ilegal de E. itajara em mercados de peixe nas costas norte (CN) e sul (CS) do Brasil. A coleta de amostras foi realizada em mercados de peixe e teve como objetivo confirmar a identificação de peixes descaracterizados e vendidos como E. itajara na CN, bem como identificar filés de peixe vendidos como garoupa verdadeira na CS. O sequenciamento de DNA por código de barras permitiu a identificação inequívoca de 22 (84,6%) das 26 amostras de mercado de peixe analisadas. Ambas as áreas amostradas tiveram confirmação da comercialização ilegal de E. itajara, e das 22 amostras analisadas, 17 (77,3%) foram confirmadas como E. itajara. Nós relatamos aqui dois crimes, a venda ilegal de E. itajara e a fraude comercial por substituição de espécies. Este estudo ressaltou que a legislação existente que protege E. itajara em águas brasileiras requer a adoção de melhores políticas públicas para a conservação da espécie.

Palavras-chave: COI, Espécies ameaçadas, Identificação molecular, Pesca ilegal, Substituição de espécies.

Introduction​


Epinephelus itajara (Lichtenstein, 1822), also known as the Atlantic goliath grouper, is the largest grouper species in the Atlantic Ocean and inhabits marine and estuarine habitats (Koenig et al., 2007). The species can live up to 37 years (Sadovy, Eklund, 1999) and reach 2.5 m (total length, TL) in size and 320 kg (Heemstra, Randall, 1993). Currently, E. itajara is classified globally as Vulnerable (VU) according to the International Union for Conservation of Nature – IUCN (Bertoncini et al., 2018). However, in Brazilian waters, the species remains classified as Critically Endangered (CR) (ICMBio, 2018).

The Atlantic goliath grouper was the first marine fish species to receive a specific fishing ban in Brazil (Hostim-Silva et al., 2005) and has been fully protected in Brazilian jurisdictional waters for over 20 years. The first ordinance was set in place in 2002 (Ordinance N° 121/2002 – IBAMA, 2002) and protected the species for five years, after that, the ordinance was renewed in 2007 (Ordinance 42/2007 – IBAMA, 2007), in 2012 (Ordinance 13/2012 – MMA/MPA, 2012), and last in 2015 (Ordinance 13/2015 – MMA/MPA, 2015) protecting the species until 2023 when the species conservation status will be reevaluated.

This iconic species suffered a severe population decline due to increasing fishing pressure along its geographical distribution areas, potentially increased by a vulnerability associated with its biological and behavioral characteristics. Similar to other Epinephelidae, E. itajara is known as slow-growing, long-lived, late maturing, and forming spawning aggregations (Sadovy, Eklund, 1999; Koenig et al., 2007), which added to the loss and/or fragmentation of habitats and the effects caused by the contamination of these environments (Koenig et al., 2011) make E. itajara particularly vulnerable to overfishing (Giglio et al., 2018).

Despite being protected in Brazilian waters, the species is still being harvested and marketed along the Brazilian Coast, especially in Northern Brazil (Silva-Oliveira et al., 2008; Giglio et al., 2014; Pereira et al., 2016; Matos et al., 2021). The biggest problem encountered in complying with the legislation is the difficulty of enforcement since the distribution area of the species along the Brazilian coast is more than 7,000 km. Besides the extensive territory and insufficient enforcement (Pereira et al., 2016, 2020), the Northern Brazilian Coast faces additional challenges, such as difficult access for enforcement agencies, resulting in an inadequate inspection process (Matos et al., 2021; Oliveira et al., 2021).

Once you find markets that commercialize endangered fish, another difficulty is in identifying the species, as most of the time fish are mischaracterized (e.g., filet, cut shape, without skin, and others), making it challenging for law enforcement to inspect and identify the illegal capture and commercialization of E. itajara and other threatened fish species(ICMBio, 2018). To solve this problem in the identification and commercialization of endangered species, molecular techniques started to be used (Bartlett, Davidson, 1991; Holmes et al., 2009; Damasceno et al., 2016; Sharrad et al., 2023). In this context, accurate species identification by applying molecular techniques represents an important tool for monitoring and inspecting fisheries (Oliveira et al., 2021). These include the use of DNA barcoding which has proven to be an important instrument and plays a key role in identifying species accurately (Hebert et al., 2003; Damasceno et al., 2016) at different life stages and even incomplete specimens and mischaracterized individuals (Basheer et al., 2014; Feitosa et al., 2018; Matos et al., 2021). This methodology has also proved to be helpful in identifying mislabeled fish products (Calegari et al., 2020) and illegal catches of protected species (Almerón-Souza et al., 2018; Matos et al., 2021). The DNA barcoding technique is a fast, safe, and robust output based on the Cytochrome c oxidase subunit I (COI) gene and has been extensively used for the identification of marine fish at the species level worldwide (Ward et al., 2005; Damasceno et al., 2016; Fadli et al., 2021; Vences et al., 2022).

Given the Atlantic goliath grouper status in Brazil, the need to preserve its stocks, and the difficulty of illegal fishing control (even after more than 20 years of the fishing ban prohibiting its capture), the present study used DNA barcoding, a valid tool to demonstrate mislabeling and illegal fishing, to analyze samples collected at fish markets in the northern and southern Brazilian coasts to identify the illegal commercialization of the species.

Material and methods


Sample collection. To test if the morphological and molecular identification of the species would match and to see how the analyzed samples would group in the tree clusters with the sequences downloaded from GenBank® we collected samples from whole morphologically identified individuals (n = 2) that dyed from being trapped at an oyster farming in the municipality of Curuçá in the State of Pará, these samples were used as control and were not used in the analyses. Sampling was conducted in fish markets on the northern (NC) and southern (SC) Brazilian coasts (Fig. 1). In the NC samples were collected in Pará from April to July 2019 (Bragança n = 20). In the SC samples were collected in São Paulo in April 2022 (Cananéia n = 1) and in Paraná from February to March 2022 (Paranaguá n = 1 and Curitiba n = 4).

FIGURE 1| Distribution of sampling sites in the northern (Pará State: Bragança n = 20 and Curuçá n = 2) and southern (São Paulo: Cananéia n = 1; Paraná: Paranaguá n = 1 and Curitiba n = 4) Brazilian coasts.

Sampling aimed to confirm the identification of fish that was mischaracterized and being sold as E. itajara in the NC, as well as identifying fish fillets that were being sold as the Dusky grouper (Epinephelus marginatus (Lowe, 1834)), in the SC. Samples were fixed in 96% ethanol placed in a 1 mL microcentrifuge tube and stored at -20 ◦C at the Laboratório de Genética e Conservação Animal at the Universidade Federal do Espírito Santo (UFES) for further processing.

DNA extraction, primer, and PCR assay. Approximately ~25 mg of each tissue sample was used for total genomic DNA extraction using the DNeasy Blood & Tissue Kit (Qiagen, Brazil). Extracted DNA samples were stored at -20 ºC until further amplification processing was implemented.

The Cytochrome c oxidase subunit I (COI) gene was amplified by PCR using the universal primer set FishF1 5’TCAACCAACCACAAAGACATTGGCAC3’ and FishR2 5’ACTTCAGGGTGACCGAAGAATCAGAA3’ (Ward et al., 2005). The amplifications were performed in 20 μl mixture reactions containing 10X buffer; 3.125 mM of MgCl2 (50 mM); 0.125 μM of each primer (10 mM), 0.05 μM of each dNTP (10 mM); 0.625 U of Taq polymerase and 20 ng of DNA template. Thermocycling conditions consisted of an initial denaturation at 95 ºC for 2 min followed by 35 cycles of denaturation at 94 °C for 30 s; annealing at 54 °C for 30 s; and elongation at 72 °C for 1 min; followed by a final 72 °C extension for 10 min.

Gel electrophoresis, staining, and DNA sequencing. The amplified fragments were separated and visualized on a 1% agarose gel. Three μL of PCR product stained with bromophenol blue and 2 μL of GelRed™ were loaded onto 1% agarose gel, along with a 100 bp DNA ladder, and electrophoresed to assess the quality of amplicons. The gel was visualized and photo-documented using a transilluminator. The remaining PCR product was purified using 1.8 μL of ExoSap-IT enzyme (USB Corporation), and the purified PCR products were sent to bidirectional sequencing using Big Dye chemistry with capillary electrophoresis in an ABI 3730xl DNA Analyzer (Seoul, KR).

Molecular data analysis. All molecular data analyses were performed with the software MEGA X (Kumar et al., 2018). Forward and reverse sequences were aligned using MUSCLE with the default settings, manually edited, and translated into protein to ensure accurate alignment and detection of stop codons, if present. The sequences’ similarity was compared with the sequences available in the Barcode of Life Online Database (BOLD) (http://www.boldsystems.org/) (Ratnasingham, Hebert, 2007) and the Basic Local Alignment Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) from GenBank® (Benson et al., 2017). A threshold of > 98 % identity was set for all sequences during identification (Hebert et al., 2003; Wainwright et al., 2018).

The Neighbor-Joining (NJ) methodology is the standard method adopted for phylogenetic inference in DNA barcoding studies (Hebert et al., 2003), and one of the reasons it is used in DNA barcoding studies is because of the capability of analyzing large species assemblages at once (Kumar, Gadadkar, 2000). Therefore, the evolutionary history was inferred by generating an NJ tree (Saitou, Nei, 1987) with 10,000 bootstrap pseudoreplications (Felsenstein, 1985). The evolutionary distances were computed using the Kimura 2-parameter (K2P) substitution model (Kimura, 1980), the most commonly used and standard model in DNA barcoding studies.

To construct the phylogenetic NJ tree, we added COI sequences available on GenBank to make sure that the specific taxa identified from the samples collected in this study would separate into specific clusters. The downloaded sequences were: E. itajara (family Epinephelidae; KF836456); E. marginatus (family Epinephelidae; KC500686); Hyporthodus niveatus (Valenciennes, 1828) (family Epinephelidae; KF836478 and KF836483); Mycteroperca bonaci (Poey, 1860) (family Epinephelidae; JQ841289 and KF836486); Conodon nobilis (Linnaeus, 1758) (family Haemulidae; JQ365304); and Conodon serrifer Jordan & Gilbert, 1882 (family Haemulidae; JQ741172 and JQ741174). The confidence of the branches was verified by Bootstrap (10.000 repetitions; Felsenstein, 1985). Centropomus undecimalis (Bloch, 1792) (family Centropomidae; JQ365276) sequence was used as an outgroup to root the tree.

Results​


The control samples collected from the whole individuals morphologically identified as E. itajara in the municipality of Curuçá in the State of Pará were confirmed by DNA barcoding as E. itajara (Tab. 1). The results of the BLAST and BOLD searches showed that from the 26 sequences from samples collected at fish markets, 22 were identified at the species level (Tab. 1), while four sequences from the municipality of Bragança (NC) were under the threshold identity, due to sequence quality, and were not used in further analyses. From the 16 analyzed samples of fish being sold as E. itajara in the State of Pará, only one was not E. itajara and was confirmed to be Conodon nobilis. The sample collected in the State of São Paulo that was being sold as Dusky grouper was E. itajara, while from the five samples that were being sold as Dusky grouper (n = 5) in the State of Paraná, one was confirmed to be E. itajara and the other four samples were confirmed to be theDusky grouper Epinephelus marginatus (Tab. 1). Therefore, from the 22 analyzed samples collected in fish markets during our study, 17 (77.3%) belonged to E. itajara.

TABLE 1 | Samples collected in the northern (Pará State: Bragança Fish Market n = 16 and Curuçá n = 2) and southern (São Paulo: Cananéia Fish Market n = 1; Paraná: Paranaguá Fish Market n = 1 and Curitiba Fish Market n = 4) Brazilian coasts. Sample information (ID), sequence size (bp), sample collection location (Location), sold as (Sold), species identification (Species), and results for identity percentage (% Identity) from the Basic Local Alignment Tool – BLAST (GenBank) and the Barcode of Life Online Database (BOLD). *Control samples from whole individuals morphologically identified as Atlantic goliath grouper.


ID

bp

Location

Sold

Species

% Identity

Genbank

Bold

E.itaPA01

699

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA03

635

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA05

686

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA08

682

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA09

667

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA12

685

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA15

676

Bragança

Atlantic goliath grouper

Epinephelus itajara

99.69

99.69

E.itaPA17

681

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA19*

646

Curuçá

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA20*

707

Curuçá

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA22

681

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA23

644

Bragança

Atlantic goliath grouper

Conodon nobilis

100

100

E.itaPA24

679

Bragança

Atlantic goliath grouper

Epinephelus itajara

99.84

99.84

E.itaPA33

819

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA34

646

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA35

668

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA36

646

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

E.itaPA41

676

Bragança

Atlantic goliath grouper

Epinephelus itajara

100

100

MOPE844

643

Curitiba

Dusky grouper

Epinephelus marginatus

100

100

MOPE897

650

Paranaguá

Dusky grouper

Epinephelus itajara

100

100

MOPE952

643

Curitiba

Dusky grouper

Epinephelus marginatus

100

100

MOPE953

643

Curitiba

Dusky grouper

Epinephelus marginatus

99.85

100

MOPE1006

643

Curitiba

Dusky grouper

Epinephelus marginatus

100

100

MOPE1007

653

Cananéia

Dusky grouper

Epinephelus itajara

100

100


Stop codons were not detected and the read lengths varied from 635 to 819 bp. For E. itajara and E. marginatus, the average nucleotide composition was G = 18.42%, C = 27.30%, A = 24.04%, and T = 30.24%, 486 conserved sites, 158 variable sites, 80 parsimony informative sites and 78 singletons (Tab. 2). The mean GC content was 45.72 ± 1.03% (Tab. 2) and decreased from the first codon position down to the third codon position. For Conodon nobilis the average nucleotide composition was G = 20.2%, C = 30.7%, A = 21.1%, and T = 28.0%, while the GC content was 50.9%, and decreased from the first to the second codon position and increased from the second to the third position.

TABLE 2 | Summary statistics for the nucleotide frequency distribution of COI sequences of samples collected in the northern and southern Brazilian coasts for Epinephelus itajara and E. marginatus.



Min

Max

Mean

SE

G %

17.9

18.6

18.42

0.2000

C %

27.2

27.8

27.30

0.1098

A %

23.8

25.0

24.04

0.3340

T %

29.3

30.4

30.24

0.2141

GC %

45.2

45.8

45.72

1.0316

GC % Codon Pos 1

57.2

58.1

57.34

0.3200

GC % Codon Pos 2

43.3

43.5

43.31

0.040

GC % Codon Pos 3

34.1

36.9

36.51

2.8974


Thirty-four congruent sequences, 24 from this study (22 from fish markets and two used as control) and 10 downloaded from GenBank were used for phylogenetic analysis and the NJ tree showed consistent clusters of conspecific sequences. All clusters were monophyletic and inter-genera relationships between E. itajara and E. marginatus and C. nobilis and Conodon serrifer were well resolved with high bootstrap values (Fig. 2), showing the efficiency of COI sequences to provide species-level resolution.

FIGURE 2| Phylogram based on cytochrome oxidase I (COI) gene amplification using the Neighbor-Joining method. The evolutionary distances were computed using the Kimura 2-parameter model with 10,000 repetitions for samples collected in the northern (Pará State: Bragança Fish Market n = 16 and Curuçá n = 2) and southern (São Paulo: Cananéia Fish Market n = 1; Paraná: Paranaguá Fish Market n = 1 and Curitiba Fish Market n = 4) Brazilian coasts. Bootstrap values are shown next to the branches. The sequences with the accession numbers were downloaded from GenBank.

Discussion​


Our study reveals that besides being protected in Brazil, E. itajara was commercialized in the sampled areas. These illegal fishing practices have been causing a huge loss for Atlantic goliath grouper recovery for two main reasons: first, the capture of younger specimens in estuarine areas negatively affects the recruitment of juveniles for the adult phase, and second, offshore fishing efforts typically concentrate on the largest and oldest individuals, principally at spawning aggregation sites, because they are more valuable economically.

Groupers form one of the most commercially valuable fish groups globally (Fadli et al., 2021), for they are highly admired due to their delicate, desirable taste and flavor (Alcantara, Yambot, 2014). Studies have shown that the fisheries directed to E. itajara coincide with spawning aggregations in austral summer, which take place from December to March (Giglio et al., 2014, 2016; Bueno et al., 2016; Matos et al., 2021), and illegally captured fish are mischaracterized (head, fins, and skin are removed) for commercialization (Silva-Oliveira et al, 2008; Pereira et al., 2020), however, during our study Atlantic goliath grouper samples were also collected from April to July, showing that the fishing pressure is not limited to the spawning aggregation period.

Previous studies have identified fish mislabeling for endangered elasmobranch species in the State of Pará (Palmeira et al., 2013; Wosnick et al., 2023). In our study, although fish were mischaracterized in the State of Pará, sellers would discretely inform customers that the fish being sold was E. itajara. The reality of the State of Pará is different from the states of São Paulo and Paraná, where fish is often mischaracterized and sold as other species, for example, the Dusky grouper E. marginatus. In this case, two crimes are being committed, the illegal sale of E. itajara and commercial fraud by the substitution of one species for another (Matos et al., 2021). The current study surveyed two areas along the Brazilian coast and 77.3% of the samples analyzed were confirmed as E. itajara, showing that besides being protected for over 20 years on the Brazilian coast, E. itajara is still being captured and commercialized, a practice that hampers conservation efforts, such as the initiatives proposed by Meros do Brasil Project (merosdobrasil.org).

Intense fishing has a negative impact on population maintenance, resulting in severe truncation of the population size and age structure (Hixon et al., 2014; Bentes et al., 2019), it can also induce evolutionary responses in fish to reproduce at a smaller size to increase reproductive success, which also increases the risk of mortality (Waples, Audzijonyte, 2016; Marshall et al., 2019). Although fisheries models have traditionally assumed that many small, young, mature females are reproductively equivalent to fewer big, old, fat, fecund, female, fish, known as BOFFFFs, the reproductive output of larger fish is higher than that of smaller fish, especially in long-lived species with low natural mortality (Hixon et al., 2014; Dick et al., 2017) such as the Atlantic goliath grouper.

Furthermore, the issue that arises from the illegal commercialization of E. itajara is not only one of conservation, but it may also have potential implications for consumer health, due to heavy metal bioaccumulation. Several studies have addressed the high concentration of mercury in Atlantic goliath grouper muscle tissue in the United States (Adams et al., 2003; Adams, Sonne, 2013; Malinowski, 2019) and Belize (Evers et al., 2009). Mercury is a heavy metal known to be a severe stressor in wildlife, including fish species (Dietz et al., 2019) as it is one of the most toxic and persistent heavy metals to all organs and tissues (Adams, Sonne, 2013; Malinowski, 2019), therefore, the regular consumption of Atlantic goliath grouper should raise concerns (Evers et al., 2009).

Here we illustrate that DNA barcoding was effective at producing sequences that identified taxonomical units to species-level resolution for the authentication of fish illegally commercialized in local fishing markets on the northern and southern Brazilian coasts. Our dataset computed GC content (or Guanine-cytosine content) mean was 45.92%, being similar to the values reported for groupers from Indonesia (46.28%; Fadli et al., 2021), the Philippines (45.16%; Alcantara, Yambot, 2014) and India (45.17%; Sachithanandam et al., 2022). The distribution of GC content is essential for assessing genetic diversity and population health and can be a useful tool for comprehending fundamental processes and can be linked to features associated with species’ life history traits (Wu et al., 2012; Alcantara, Yambot, 2014), however, environmental elements including genome size, temperature, oxygen need, and habitat can be linked to the mechanism of GC content variation in different species (Wu et al., 2012; Alcantara, Yambot, 2014; Sachithanandam et al., 2022).

Our results show that the laws that protect the Atlantic goliath grouper in Brazil are not effective in identifying illegal catches (Torres et al., 2013), and as a result, the species is still facing fishing pressure and exposure to overexploitation and depletion; especially during spawning aggregation events (Silva-Oliveira et al., 2008; Bueno et al., 2016; Giglio et al., 2017; Pereira et al., 2020; Bravo-Calderon et al., 2021), an ecological trait that contributes to the vulnerability of the species to fishing. These findings highlight that it is necessary to strengthen enforcement and awareness efforts to ensure compliance with protective regulations.

The inspection difficulties faced by public authorities due to mischaracterized individuals and the large extension of the Brazilian coast present a complex and delicate management challenge for the Atlantic goliath grouper, consequently, conservation efforts and recovery plans that require a multitude of comprehensive actions are required to ensure the species protection. Therefore, considering E. itajara vulnerability to extinction (de Mitcheson et al., 2012; Bravo-Calderon et al., 2021), our results are important to raise awareness of its protection, once consumer awareness is essential for preventing the commercialization of endangered species and protecting biodiversity.

The world is experiencing a global trend of sustainable consumption (Mitchell, 2011; Simeone, Scarpato, 2020), and some consumers may refrain from purchasing threatened species if they are aware of how their decision will affect the ecosystem (Guillen et al., 2019), thus, informed consumers might play a significant role in the conservation of endangered species, such as the Atlantic goliath grouper. As a result, it is wise to educate and engage people in conservation initiatives, as this is an important asset for successful management and biodiversity protection.

Acknowledgments​


This research was developed and funded by Meros do Brasil Project, sponsored by Petrobras. LLA thanks CAPES for the scholarships (PDSE – 88881.361817/2019–01 and PDS – 88882.385188/2019–01). MHS thanks the research fellowships provided by CNPq (Proc. 312278/2017–9) and FAPES for the Research Support Program grant (TO: 221/2019).

References​


Adams DH, McMichael RH Jr., Henderson GE. Mercury levels in marine and estuarine fishes of Florida 1989–2001. Florida Marine Research Institute, 2nd ed. rev. 2003.

Adams DH, Sonne C. Mercury and histopathology of the vulnerable goliath grouper, Epinephelus itajara, in US waters: a multi-tissue approach. Environ Res. 2013; 126:254–63. https://doi.org/10.1016/j.envres.2013.05.010

Alcantara SG, Yambot AV. DNA barcoding of commercially important Grouper species (Perciformes, Serranidae) in the Philippines. Mitochondrial DNA Part A. 2014; 27(6):3837–45. https://doi.org/10.3109/19401736.2014.958672

Almerón-Souza F, Sperb C, Castilho CL, Figueiredo PICC, Gonçalves LT, Machado R et al. Molecular Identification of Shark Meat from Local Markets in Southern Brazil Based on DNA Barcoding: Evidence for Mislabeling and Trade of Endangered Species. Front Genet. 2018; 9:138. https://doi.org/10.3389/fgene.2018.00138

Bartlett SE, Davidson WS. Identification of Thunnus tuna species by the polymerase chain reaction and direct sequence analysis of their mitochondrial cytochrome b genes. Canadian J Fish Aquai Sci. 1991; 48(2):309–17. https://doi.org/10.1139/f91-043

Basheer VS, Mohitha C, Vineesh N, Divya PR, Gopalakrishnan A, Jena JK. Molecular phylogenetics of three species of the genus Rastrelliger using mitochondrial DNA markers. Mol Biol Rep. 2014; 42:873–79. https://doi.org/10.1007/s11033-014-3710-8

Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Ostell J, Pruitt KD et al. GenBank. Nucleic Acids Res. 2017; 46(D1):D41–D47. https://doi.org/10.1093/nar/gkx1094

Bentes B, Mendes NCB, Viana CS, Romão Jr. JG, Silva KCA, Andrade CER et al. Incidental catch of goliath grouper Epinephelus itajara (Lichtenstein, 1822) e Epinephelus sp (Bloch, 1793) in industrial fisheries of Brazilian northern coast: a critical endangerous species. Biota Amazôn. 2019; 9(1):58–59. http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v9n1p58-59

Bertoncini AA, Aguilar-Perera A, Barreiros J, Craig MT, Ferreira B, Koenig C. Epinephelus itajara (errata version published in 2019). The IUCN Red List of Threatened Species 2018. 2018; e.T195409A145206345. https://doi.org/10.2305/IUCN.UK.2018-2.RLTS.195409A145206345.en

Bravo-Calderon A, Saenz-Arroyo A, Fulton S, Espinoza-Tenorio A, Sosa-Cordero E. Goliath grouper Epinephelus itajara oral history, use, and conservation status in the Mexican Caribbean and Campeche Bank. Endanger Species Res. 2021; 45:283–300. https://doi.org/10.3354/esr01135

Bueno LS, Bertoncini AA, Koenig CC, Coleman FC, Freitas MO, Leite JR et al. Evidence for spawning aggregations of the endangered Atlantic goliath grouper Epinephelus itajara in southern Brazil. J Fish Biol. 2016; 89(1):76–889. https://doi.org/10.1111/jfb.13028

Calegari BB, Avila EF, Reis RE, Alho CS. DNA barcode authentication reveals highly fraudulent Cod commerce in Porto Alegre, Brazil. Forensic Sci Int Rep. 2020; 2:100072. http://doi.org/10.1016/j.fsir.2020.100072

Damasceno JS, Siccha-Ramirez R, Oliveira C, Mendonça FF, Lima AC, Machado LF et al. Molecular identification of Atlantic goliath grouper Epinephelus itajara (Lichtenstein, 1822) (Perciformes: Epinephelidae) and related commercial species applying multiplex PCR. Neotrop Ichthyol. 2016; 14(3):e150128. https://doi.org/10.1590/1982-0224-20150128

Dick EJ, Beyer S, Mangel M, Ralston S. A meta-analysis of fecundity in rockfishes (genus Sebastes). Fish Res. 2017; 187:73–85. https://doi.org/10.1016/j.fishres.2016.11.009

Dietz R, Letcher RJ, Desforges J-P, Eulaers I, Sonne C, Wilson S et al. Current state of knowledge on biological effects from contaminants on arctic wildlife and fish. Sci Total Environ. 2019; 696:133792. https://doi.org/10.1016/j.scitotenv.2019.133792

Evers DC, Graham RT, Perkins CR, Michener R, Divoll T. Mercury concentrations in the goliath grouper of Belize: an anthropogenic stressor of concern. Endanger. Species Res. 2009; 7:249–56. https://doi.org/10.3354/esr00158

Fadli N, Muchlisin ZA, Siti-Azizah MN. DNA barcoding of commercially important groupers (Epinephelidae) in Aceh, Indonesia. Fish Res. 2021; 234:105796. https://doi.org/10.1016/j.fishres.2020.105796

Feitosa LM, Martins APB, Giarrizzo T, Macedo W, Monteiro IL, Gemaque R et al. DNA-based identification reveals illegal trade of threatened shark species in a global elasmobranch conservation hotspot. Sci Rep. 2018; 8:3347. https://doi.org/10.1038/s41598-018-21683-5

Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985; 39(4):783–91. https://doi.org/10.2307/2408678

Giglio VJ, Bender MG, Zapelini C, Ferreira CEL. The end of the line? Rapid depletion of a large-sized grouper through spearfishing in a subtropical marginal reef. Perspect Ecol Conserv. 2017; 15(2):115–18. https://doi.org/10.1016/j.pecon.2017.03.006

Giglio VJ, Bertoncini AA, Ferreira BP, Hostim-Silva M, Freitas MO. Landings of goliath grouper, Epinephelus itajara, in Brazil: Despite prohibited over ten years, fishing continues. Nat Conserv. 2014; 12(2):118–23. https://doi.org/10.1016/j.ncon.2014.09.004

Giglio VJ, Leite JR, Freitas MO, Hostim-Silva M. Mapping goliath grouper aggregations in the Southwestern Atlantic. Braz J Oceanogr. 2016; 64(4):417–20. https://doi.org/10.1590/s1679-87592016122906404

Giglio VJ, Ternes MLF, Luiz OJ, Zapelini C, Freitas MO. Human consumption and popular knowledge on the conservation status of groupers and sharks caught by small-scale fisheries on Abrolhos Bank, SW Atlantic. Mar Policy. 2018; 89:142–46. https://doi.org/10.1016/j.marpol.2017.12.020

Guillen J, Natale F, Carvalho N, Casey J, Hofherr J, Druon J-N et al. Global seafood consumption footprint. Ambio. 2019; 48:111–22. https://doi.org/10.1007/s13280-018-1060-9

Hebert PDN, Cywinska A, Ball SL, deWaard JR. Biological identifications through DNA barcodes. Proc R Soc Lond B. 2003; 270(1512):313–22. https://doi.org/10.1098/rspb.2002.2218

Heemstra PC, Randall JE. Groupers of the world. FAO Fisheries Synopsis. Rome: Food and Agriculture Organization. 1993; 16:382.

Hixon MA, Johnson DW, Sogard SM. BOFFFFs: on the importance of conserving old-growth age structure in fishery populations. ICES J Mar Sci. 2014; 71(8):2171–85. https://doi.org/10.1093/icesjms/fst200

Holmes BH, Steinke D, Ward RD. Identification of shark and ray fins using DNA barcoding. Fish Res. 2009; 95(2–3):280–88. https://doi.org/10.1016/j.fishres.2008.09.036

Hostim-Silva M, Bertoncini AA, Gerhardinger LC, Machado LF. The “Lord of the Rock’s” conservation program in Brazil: the need for a new perception of marine fishes. Coral Reefs. 2005; 24:74. https://doi.org/10.1007/s00338-004-0437-3

Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA). Portaria IBAMA 121, de 20 de setembro de 2002. [Internet]. 2002. Available from: https://www.icmbio.gov.br/cepsul/images/stories/legislacao/Portaria/2002/p_ibama_121_2002_moratoria5anospescadomero_alterada_p_ibama_42_2007.pdf

Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA). Portaria IBAMA no 42, de 19 de setembro de 2007. [Internet]. 2007. Available from: https://www.icmbio.gov.br/cepsul/images/stories/legislacao/Portaria/2007/p_ibama_42_2007_defesomero_altera_p_ibama_121_2002.pdf

Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio). Ministry of the Environment (ICMBio/MMA), Brazil (2018) Livro Vermelho da Fauna Brasileira Ameaçada de Extinção: Vol. VI – Peixes. [Internet] 2018. Available from: https://www.gov.br/icmbio/pt-br/centrais-de-conteudo/publicacoes/publicacoes-diversas/livro_vermelho_2018_vol6.pdf

Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980; 16:111–20. https://doi.org/10.1007/BF01731581

Koenig CC, Coleman FC, Eklund AM, Schull J, Ueland J. Mangroves as essential nursery habitat for goliath grouper (Epinephelus itajara). Bull Mar Sci. 2007; 80(3):567–86.

Koenig CC, Coleman FC, Kingon K. Pattern of recovery of the goliath grouper Epinephelus itajara population in the Southeastern US. Bull Mar Sci. 2011; 87(4):891–911. https://doi.org/10.5343/bms.2010.1056

Kumar S, Gadadkar SR. Efficiency of the neighbor-joining method in reconstructing deep and shallow evolutionary relationships in large phylogenies. J Mol Evol. 2000; 51:544–53. https://doi.org/10.1007/s002390010118

Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018; 35(6):1547–49. https://doi.org/10.1093/molbev/msy096

Malinowski CR. High mercury concentrations in Atlantic Goliath Grouper: Spatial analysis of a vulnerable species. Mar Pollut Bull. 2019; 143:81–91. https://doi.org/10.1016/j.marpolbul.2019.04.006

Marshall DJ, Gaines S, Warner R, Barneche DR, Bode M. Underestimating the benefits of marine protected areas for the replenishment of fished populations. Front Ecol Environ. 2019; 17(7):407–13. https://doi.org/10.1002/fee.2075

Matos MJS, Gomes CM, Oliveira-Filho AB, Vallinoto M, Silva-Oliveira GC. Genetic material reveals illegal sale in northern Brazil: the case of the critically endangered species Epinephelus itajara. Conserv Genet Resour. 2021; 13:389–93. https://doi.org/10.1007/s12686-021-01221-8

Ministério do Meio Ambiente e Ministério da Pesca e Aquicultura (MMA/MPA). Instrução Normativa Interministerial no 13, de 16 de outubro de 2012. [Internet]. 2012. Available from: https://www.ibama.gov.br/component/legislacao/?view=legislacao&legislacao=128307

Ministério do Meio Ambiente e Ministério da Pesca e Aquicultura (MMA/MPA). Portaria Interministerial no 13, de 2 de outubro de 2015. [Internet]. 2015. Available from: https://www.icmbio.gov.br/cepsul/images/stories/legislacao/Portaria/2015/p_mpa_mma_13_2015_proibe_pesca_mero.pdf

Mitchell M. Increasing fish consumption for better health: are we being advised to eat more of an inherently unsustainable protein? Nutr Bull. 2011; 36(4):438–42. https://doi.org/10.1111/j.1467-3010.2011.01926.x

de Mitcheson YS, Colin PL. Species case studies. In: Sadovy de Mitcheson Y, Colin P, editors. Reef fish spawning aggregations: biology, research, and management. Fish Fish Ser. 2012; 35:417–22. https://doi.org/10.1007/978-94-007-1980-4_12

Oliveira Y, Alencar R, Oliveira Y, Torres RA, Sampaio I, Vallinoto M et al. Simple and safe approach for molecular identification of the endangered species Epinephelus itajara. Conserv Genet Resour. 2021; 13:127–30. https://doi.org/10.1007/s12686-021-01195-7

Palmeira CAM, Silva Rodrigues-Filho LF, Sales JBL, Vallinoto M, Schneider H, Sampaio I. Commercialization of a critically endangered species (largetooth sawfish, Pristis perotteti) in fish markets of northern Brazil: authenticity by DNA analysis. Food Control. 2013; 34(1):249–52. https://doi.org/10.1016/j.foodcont.2013.04.017

Pereira LJG, Fernandes SCP, Gonçalves FFM, Andrade CER, Bentes B. Multidisciplinary analysis of a forbidden fishery: case study of the fishery of goliath grouper Epinephelus itajara (Lichtenstein, 1822) in Pará coast, oriental Amazon. Res Soc Dev. 2020; 9(8):e944986338. https://doi.org/10.33448/rsd-v9i8.6338

Pereira LJG, Fernandes SCP, Gonçalves FFM, Maia RCN, Barboza RSL, Bentes BS. Conhecimento ecológico local sobre o mero Epinephelus itajara (Lichtenstein, 1822) no Nordeste Paraense Amazônico. Biota Amazôn. 2016; 6(2):110–19.

Ratnasingham S, Hebert PDN. BARCODING: bold: The barcode of life data system (http://www.barcodinglife.org). Mol Ecol Notes. 2007; 7(3):355–64. https://doi.org/10.1111/j.1471-8286.2007.01678.x

Sachithanandam V, Muruganandam N, Say D, Mayekar TS, Mohan PM. Barcode and phylogenetic analysis of serranidae fish (subfamily: Epinephelinae) from a tropical island ecosystem of the Indian Ocean. Thalassas. 2022; 38:843–53. https://doi.org/10.1007/s41208-022-00427-3

Sadovy Y, Eklund AM. Synopsis of biological data on the Nassau grouper, Epinephelus striatus (Bloch 1792), and the jewfish, E. itajara (Lichtenstein 1822). NOAA Tech Rep NMFS. Washington, D.C. National Oceanic and Atmospheric Administration. 1999; 146:65.

Saitou N, Nei M. The Neighbor-Joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4(4):406–25. https://doi.org/10.1093/oxfordjournals.molbev.a040454

Sharrad AE, Reis-Santos P, Austin J, Gillanders BM. Umbrella terms conceal the sale of threatened shark species: A DNA barcoding approach. Food Control. 2023; 148:109606. https://doi.org/10.1016/j.foodcont.2023.109606

Silva-Oliveira GC, Rêgo PS, Schneider H, Sampaio I, Vallinoto M. Genetic characterization of populations of the critically endangered Goliath grouper (Epinephelus itajara, Serranidae) from the Northern Brazilian coast through analyses of mtDNA. Genet Mol Biol. 2008; 31(4):988–95. https://doi.org/10.1590/S1415-47572008005000016

Simeone M, Scarpato D. Sustainable consumption: How does social media affect food choices? J Clean Prod. 2020; 277:124036. https://doi.org/10.1016/j.jclepro.2020.124036

Torres RA, Feitosa RB, Carvalho DC, Freitas MO, Hostim-Silva M, Ferreira BP. DNA barcoding approaches for fishing authentication of exploited grouper species including the endangered and legally protected goliath grouper Epinephelus itajara. Sci Mar. 2013; 77:409–18. https://doi.org/10.3989/scimar.03805.29A

Vences M, Stützer D, Raminosoa NR, Ziegler T. Towards a DNA barcode library for Madagascar’s threatened ichthyofauna. PLoS ONE. 2022; 17(8):e0271400. https://doi.org/10.1371/journal.pone.0271400

Wainwright BJ, Ip YCA, Neo ML, Chang JJM, Gan CZ, Clark-Shen N et al. DNA barcoding of traded shark fins, meat, and mobulid gill plates in Singapore uncovers numerous threatened species. Conserv Genet. 2018; 19:1393–99. https://doi.org/10.1007/s10592-018-1108-1

Waples RS, Audzijonyte A. Fishery-induced evolution provides insights into adaptive responses of marine species to climate change. Front Ecol Environ. 2016; 14(4):217–24. https://doi.org/10.1002/fee.1264

Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN. DNA barcoding Australia’s fish species. Phil Trans R Soc B. 2005; 360(1462):1847–57. https://doi.org/10.1098/rstb.2005.1716

Wosnick N, Charvet P, Hauser-Davis RA, Rincon G, Nunes AROP, Nunes JLS. Unveiling the threats beneath: fish mislabeling in the Brazilian Amazon coast and its impacts on the critically endangered daggernose shark. Fisheries. 2023; 48(11):469–73. https://doi.org/10.1002/fsh.10983

Wu H, Zhang H, Hu S, Yu J. On the molecular mechanism of GC content variation among eubacterial genomes. Biol Direct. 2012; 7(2). https://doi.org/10.1186/1745-6150-7-2

Authors


Lorena Lopes Almeida1,2,3 , Maurício Hostim-Silva1,3,4,5, Mario Vinicius Condini3,4, Matheus Oliveira Freitas5, Leonardo Schlögel Bueno5, Bianca Bentes6, Luciano de Jesus Gomes Pereira6 and Ana Paula Cazerta Farro1,2,4

[1]    Programa de Pós-Graduação em Biologia Animal (PPGBAN), Departamento de Ciências Biológicas, Universidade Federal do Espírito Santo (UFES), Av. Fernando Ferrari, 514, Goiabeiras, 29075-910 Vitória, ES, Brazil. (LLA) lorenalopesbio@gmail.com (corresponding author).

[2]    Laboratório de Genética e Conservação Animal, Universidade Federal do Espírito Santo (UFES), Departamento de Ciências Agrárias e Biológicas, BR-101, km 60, Litorâneo, 29932-540 São Mateus, ES, Brazil. (APCF) farro.ana@gmail.com.

[3]    Laboratório de Ecologia de Peixes Marinhos (LEPMAR), Universidade Federal do Espírito Santo (UFES), Departamento de Ciências Agrárias e Biológicas, BR-101, km 60, Litorâneo, 29932-540 São Mateus, ES, Brazil. (MHS) mhostim@gmail.com.

[4]    Programa de Pós-Graduação em Oceanografia Ambiental (PPGOAM), Universidade Federal do Espírito Santo (UFES), Av. Fernando Ferrari, 514, Goiabeiras, 29075-910 Vitória, ES, Brazil. (MVC) mvcondini@gmail.com.

[5]    Instituto Meros do Brasil (IMB), Rua Benjamin Cosntant 67, Conj. 1104, 10° andar, 80060-020 Curitiba, PR, Brazil. (MOF) serranidae@gmail.com, (LSB) lecobueno@gmail.com.

[6]    Núcleo de Ecologia Aquática e Pesca (NEAP), Universidade Federal do Pará, Rua Augusto Corrêa, 01, Guamá, 66075-110 Belém, PA, Brazil. (BB) bianca@ufpa.br, (LJGP) luciano.jgp@gmail.com.

Authors’ Contribution


Lorena Lopes Almeida: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Software, Validation, Visualization, Writing-original draft, Writing-review and editing.

Maurício Hostim-Silva: Conceptualization, Funding acquisition, Investigation, Project administration, Supervision, Writing-review and editing.

Mario Vinicius Condini: Data curation, Project administration, Supervision, Visualization, Writing-review and editing.

Matheus Oliveira Freitas: Conceptualization, Data curation, Funding acquisition, Visualization, Writing-review and editing.

Leonardo Schlögel Bueno: Conceptualization, Data curation, Resources, Writing-review and editing.

Bianca Bentes: Data curation, Resources, Writing-review and editing.

Luciano de Jesus Gomes Pereira: Data curation, Resources.

Ana Paula Cazerta Farro: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Resouces, Supervision, Validation, Visualization, Writing-original draft, Writing-review and editing.

Ethical Statement​


All sample collections were performed under license number SISBIO 15080-7.

Competing Interests


The author declares no competing interests.

How to cite this article


Almeida LL, Hostim-Silva M, Condini MV, Freitas MO, Bueno LS, Bentes B, Pereira LJG, Farro APC. Mislabeling, illegal capture, and commercialization of Atlantic goliath grouper (Epinephelus itajara) on the Brazilian coast using DNA barcoding. Neotrop Ichthyol. 2024; 22(1):e230099. https://doi.org/10.1590/1982-0224-2023-0099


This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Distributed under

Creative Commons CC-BY 4.0

© 2024 The Authors.

Diversity and Distributions Published by SBI

Accepted December 3, 2023 by Osmar Luiz

Submitted August 29, 2023

Epub February 23, 2024